Incidental Mutation 'R6134:Rasa1'
ID 487298
Institutional Source Beutler Lab
Gene Symbol Rasa1
Ensembl Gene ENSMUSG00000021549
Gene Name RAS p21 protein activator 1
Synonyms p120-rasGAP, Gap
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6134 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 85214780-85289130 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85226626 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 742 (L742P)
Ref Sequence ENSEMBL: ENSMUSP00000105179 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109552]
AlphaFold E9PYG6
Predicted Effect probably benign
Transcript: ENSMUST00000109552
AA Change: L742P

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000105179
Gene: ENSMUSG00000021549
AA Change: L742P

DomainStartEndE-ValueType
low complexity region 3 32 N/A INTRINSIC
low complexity region 37 106 N/A INTRINSIC
low complexity region 119 142 N/A INTRINSIC
SH2 170 253 9.44e-29 SMART
SH3 273 331 1.7e-10 SMART
SH2 340 423 7.44e-27 SMART
PH 466 570 5.11e-20 SMART
C2 586 680 6.9e-10 SMART
RasGAP 689 1035 2.77e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141879
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142285
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149799
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152466
Predicted Effect probably benign
Transcript: ENSMUST00000163713
SMART Domains Protein: ENSMUSP00000130820
Gene: ENSMUSG00000021548

DomainStartEndE-ValueType
Pfam:Cyclin_C_2 1 65 2.4e-20 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000223598
AA Change: L200P
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is located in the cytoplasm and is part of the GAP1 family of GTPase-activating proteins. The gene product stimulates the GTPase activity of normal RAS p21 but not its oncogenic counterpart. Acting as a suppressor of RAS function, the protein enhances the weak intrinsic GTPase activity of RAS proteins resulting in the inactive GDP-bound form of RAS, thereby allowing control of cellular proliferation and differentiation. Mutations leading to changes in the binding sites of either protein are associated with basal cell carcinomas. Mutations also have been associated with hereditary capillary malformations (CM) with or without arteriovenous malformations (AVM) and Parkes Weber syndrome. Alternative splicing results in two isoforms where the shorter isoform, lacking the N-terminal hydrophobic region but retaining the same activity, appears to be abundantly expressed in placental but not adult tissues. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced embryonic growth associated with defects of both yolk sac and embryonic vascular systems resulting in lethality by embryonic day 10.5. Mice homozygous for a knock-in allele exhibit increased sensitivity to induced cell death and colitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pck2 T A 14: 55,543,962 M180K probably damaging Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Rasa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00863:Rasa1 APN 13 85288429 missense probably benign 0.02
IGL01396:Rasa1 APN 13 85258442 missense probably benign 0.10
IGL01670:Rasa1 APN 13 85225490 missense probably damaging 0.97
IGL02095:Rasa1 APN 13 85216155 missense probably benign 0.10
IGL02822:Rasa1 APN 13 85252514 missense probably damaging 0.97
IGL03126:Rasa1 APN 13 85256396 missense possibly damaging 0.94
F5770:Rasa1 UTSW 13 85226945 splice site probably null
PIT4458001:Rasa1 UTSW 13 85227118 missense possibly damaging 0.91
R1393:Rasa1 UTSW 13 85223522 missense probably damaging 1.00
R1441:Rasa1 UTSW 13 85252421 splice site probably null
R1907:Rasa1 UTSW 13 85226572 nonsense probably null
R4243:Rasa1 UTSW 13 85244195 missense probably damaging 1.00
R4593:Rasa1 UTSW 13 85238221 splice site probably null
R4687:Rasa1 UTSW 13 85226635 missense possibly damaging 0.89
R4689:Rasa1 UTSW 13 85238163 nonsense probably null
R4753:Rasa1 UTSW 13 85288390 splice site probably null
R4758:Rasa1 UTSW 13 85234448 missense probably benign
R4774:Rasa1 UTSW 13 85250502 intron probably benign
R5363:Rasa1 UTSW 13 85288555 missense possibly damaging 0.86
R5375:Rasa1 UTSW 13 85288903 intron probably benign
R6190:Rasa1 UTSW 13 85233695 missense probably benign 0.02
R6755:Rasa1 UTSW 13 85226598 missense possibly damaging 0.49
R7564:Rasa1 UTSW 13 85228708 missense probably benign 0.09
R7862:Rasa1 UTSW 13 85255411 missense probably damaging 0.99
R9138:Rasa1 UTSW 13 85221516 missense possibly damaging 0.93
R9280:Rasa1 UTSW 13 85288613 missense unknown
R9328:Rasa1 UTSW 13 85255456 critical splice acceptor site probably null
R9340:Rasa1 UTSW 13 85221530 missense probably damaging 0.98
RF016:Rasa1 UTSW 13 85223488 missense possibly damaging 0.65
X0023:Rasa1 UTSW 13 85233734 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGGCCTTGGAACTGATATAGAATG -3'
(R):5'- CCTATATTAATGGCAGAGAAGAAGC -3'

Sequencing Primer
(F):5'- CACCACTGTTGATCACAC -3'
(R):5'- TGTGTACTTTCAGCAGTCT -3'
Posted On 2017-10-10