Incidental Mutation 'R6134:Pck2'
ID487300
Institutional Source Beutler Lab
Gene Symbol Pck2
Ensembl Gene ENSMUSG00000040618
Gene Namephosphoenolpyruvate carboxykinase 2 (mitochondrial)
Synonyms1810010O14Rik, 9130022B02Rik
MMRRC Submission 044281-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.200) question?
Stock #R6134 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location55540266-55551242 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 55543962 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 180 (M180K)
Ref Sequence ENSEMBL: ENSMUSP00000154736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048781] [ENSMUST00000226352] [ENSMUST00000226519] [ENSMUST00000228240]
Predicted Effect probably damaging
Transcript: ENSMUST00000048781
AA Change: M215K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000038555
Gene: ENSMUSG00000040618
AA Change: M215K

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PEPCK 73 664 1.9e-276 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000226231
AA Change: M96K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226270
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226295
Predicted Effect probably damaging
Transcript: ENSMUST00000226352
AA Change: M188K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226514
Predicted Effect probably damaging
Transcript: ENSMUST00000226519
AA Change: M188K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect unknown
Transcript: ENSMUST00000226650
AA Change: M178K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226664
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226770
Predicted Effect probably damaging
Transcript: ENSMUST00000228240
AA Change: M180K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228843
Predicted Effect probably benign
Transcript: ENSMUST00000228921
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 94% (51/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial enzyme that catalyzes the conversion of oxaloacetate to phosphoenolpyruvate in the presence of guanosine triphosphate (GTP). A cytosolic form of this protein is encoded by a different gene and is the key enzyme of gluconeogenesis in the liver. Alternatively spliced transcript variants have been described. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik G A 11: 58,876,793 E39K probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Aktip T A 8: 91,129,760 S30C probably damaging Het
Anxa10 G T 8: 62,077,943 H78N probably damaging Het
Aoah C T 13: 20,911,123 R196W probably damaging Het
Arl4c A T 1: 88,701,430 W79R probably damaging Het
Brd2 A T 17: 34,113,695 D178E probably benign Het
Cacna1e G A 1: 154,701,291 P120L probably damaging Het
Cdh16 A T 8: 104,616,065 M17K probably benign Het
Chit1 A G 1: 134,144,060 T103A possibly damaging Het
Clcn3 T C 8: 60,934,573 Y214C probably damaging Het
Coch T A 12: 51,602,753 D282E probably damaging Het
Col1a2 C A 6: 4,538,035 S1181R unknown Het
Col6a2 T C 10: 76,607,144 D506G probably damaging Het
Crx A T 7: 15,868,107 Y215* probably null Het
Fam160a1 T C 3: 85,673,344 E518G possibly damaging Het
Fasn A T 11: 120,822,186 S58T probably benign Het
Garem1 A T 18: 21,129,824 D644E probably benign Het
Gm4763 G A 7: 24,726,056 A3V probably damaging Het
H2-Q2 A C 17: 35,343,241 T155P probably damaging Het
Insr A T 8: 3,192,572 I49N probably damaging Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lnpep A G 17: 17,553,192 M639T probably benign Het
Map3k20 C T 2: 72,410,159 S333F probably damaging Het
Miga2 A G 2: 30,371,217 S175G probably benign Het
Muc3a A T 5: 137,210,122 I191N probably damaging Het
Ncoa2 A G 1: 13,174,371 V701A probably damaging Het
Nid2 T C 14: 19,778,783 V565A probably damaging Het
Nova2 G A 7: 18,957,869 A244T unknown Het
Numbl G C 7: 27,281,314 A574P probably damaging Het
Oas3 A G 5: 120,769,048 V508A unknown Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
Otx1 A T 11: 21,999,406 L24H probably damaging Het
Pcdhb21 T A 18: 37,514,408 S197T probably benign Het
Pgr T C 9: 8,900,739 V91A possibly damaging Het
Phtf1 A T 3: 104,004,405 M643L probably damaging Het
Prokr1 T C 6: 87,588,855 T3A possibly damaging Het
Ptgs1 T C 2: 36,251,178 Y546H probably damaging Het
Rasa1 A G 13: 85,226,626 L742P probably benign Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rgs22 A G 15: 36,107,048 L64P probably damaging Het
Rnf213 A T 11: 119,411,470 I407F probably damaging Het
Rp1l1 C T 14: 64,030,096 P1044S probably damaging Het
RP24-388A6.3 A T 5: 16,824,685 D473V probably damaging Het
Scin G A 12: 40,060,579 P690L probably damaging Het
Sept9 T C 11: 117,352,161 L58P probably damaging Het
Slc1a7 A G 4: 108,012,436 E566G probably damaging Het
Speer4f1 G A 5: 17,476,142 R6Q probably benign Het
Tnxb A T 17: 34,672,012 Y443F probably damaging Het
Trpv1 A G 11: 73,244,317 I79V probably benign Het
Ttll6 C T 11: 96,139,742 T245I possibly damaging Het
Vmn2r26 T C 6: 124,061,485 I673T probably damaging Het
Zfp60 T C 7: 27,749,898 F664L probably benign Het
Other mutations in Pck2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Pck2 APN 14 55542641 missense probably benign 0.30
IGL00430:Pck2 APN 14 55543944 missense probably benign 0.07
IGL00814:Pck2 APN 14 55548299 unclassified probably benign
IGL01012:Pck2 APN 14 55544069 splice site probably benign
IGL02095:Pck2 APN 14 55542510 missense probably benign 0.02
IGL02227:Pck2 APN 14 55543866 missense probably benign
IGL02435:Pck2 APN 14 55544390 splice site probably benign
IGL03124:Pck2 APN 14 55545333 missense probably damaging 1.00
R0271:Pck2 UTSW 14 55544584 critical splice donor site probably null
R1014:Pck2 UTSW 14 55542410 missense probably benign 0.00
R1116:Pck2 UTSW 14 55545366 missense probably benign 0.00
R1640:Pck2 UTSW 14 55548584 missense possibly damaging 0.51
R1793:Pck2 UTSW 14 55543965 missense possibly damaging 0.81
R1965:Pck2 UTSW 14 55542507 missense probably benign 0.07
R1983:Pck2 UTSW 14 55544068 splice site probably null
R3196:Pck2 UTSW 14 55543992 missense probably damaging 1.00
R4751:Pck2 UTSW 14 55542561 missense probably damaging 1.00
R5385:Pck2 UTSW 14 55545231 missense probably damaging 1.00
R5960:Pck2 UTSW 14 55548547 missense possibly damaging 0.48
R6276:Pck2 UTSW 14 55542624 missense probably damaging 1.00
R7030:Pck2 UTSW 14 55547766 missense probably damaging 1.00
R7199:Pck2 UTSW 14 55548712 missense probably benign 0.43
R7516:Pck2 UTSW 14 55542456 missense probably benign 0.00
R8066:Pck2 UTSW 14 55544401 missense probably benign 0.30
X0065:Pck2 UTSW 14 55548063 missense probably benign 0.01
Z1176:Pck2 UTSW 14 55545269 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACGAGAGATTCCCAGGATGC -3'
(R):5'- ATCCACAATTTCTCCGTGGATGG -3'

Sequencing Primer
(F):5'- ATTCCCAGGATGCATGCAG -3'
(R):5'- CACAATTTCTCCGTGGATGGGTAAG -3'
Posted On2017-10-10