Mutagenetix > Incidental Mutation

Incidental Mutation 'R6134:Rgs22'

487302

Institutional Source

Beutler Lab

Gene Symbol

Rgs22

Ensembl Gene

ENSMUSG00000037627

Gene Name

regulator of G-protein signalling 22

Synonyms

MMRRC Submission

044281-MU

Accession Numbers

Genbank: NM_001195748; MGI: 3613651

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

36009479-36140400 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36107048 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 64 (L64P)

Ref Sequence

ENSEMBL: ENSMUSP00000134259 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172831] [ENSMUST00000174881]

AlphaFold

G3UYX5

Predicted Effect

probably damaging
Transcript: ENSMUST00000172831
AA Change: L64P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134259
Gene: ENSMUSG00000037627
AA Change: L64P

Domain	Start	End	E-Value	Type
low complexity region	9	19	N/A	INTRINSIC
low complexity region	62	76	N/A	INTRINSIC
low complexity region	173	179	N/A	INTRINSIC
low complexity region	376	391	N/A	INTRINSIC
RGS	845	973	3.15e-2	SMART
RGS	1014	1134	1.56e-15	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000174881
AA Change: L25P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000134185
Gene: ENSMUSG00000037627
AA Change: L25P

Domain	Start	End	E-Value	Type
low complexity region	23	37	N/A	INTRINSIC
low complexity region	252	267	N/A	INTRINSIC
RGS	721	849	3.15e-2	SMART
RGS	890	1010	1.56e-15	SMART

Meta Mutation Damage Score

0.3800

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

94% (51/54)

Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,876,793	E39K	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Aktip	T	A	8: 91,129,760	S30C	probably damaging	Het
Anxa10	G	T	8: 62,077,943	H78N	probably damaging	Het
Aoah	C	T	13: 20,911,123	R196W	probably damaging	Het
Arl4c	A	T	1: 88,701,430	W79R	probably damaging	Het
Brd2	A	T	17: 34,113,695	D178E	probably benign	Het
Cacna1e	G	A	1: 154,701,291	P120L	probably damaging	Het
Cdh16	A	T	8: 104,616,065	M17K	probably benign	Het
Chit1	A	G	1: 134,144,060	T103A	possibly damaging	Het
Clcn3	T	C	8: 60,934,573	Y214C	probably damaging	Het
Coch	T	A	12: 51,602,753	D282E	probably damaging	Het
Col1a2	C	A	6: 4,538,035	S1181R	unknown	Het
Col6a2	T	C	10: 76,607,144	D506G	probably damaging	Het
Crx	A	T	7: 15,868,107	Y215*	probably null	Het
Fam160a1	T	C	3: 85,673,344	E518G	possibly damaging	Het
Fasn	A	T	11: 120,822,186	S58T	probably benign	Het
Garem1	A	T	18: 21,129,824	D644E	probably benign	Het
Gm4763	G	A	7: 24,726,056	A3V	probably damaging	Het
H2-Q2	A	C	17: 35,343,241	T155P	probably damaging	Het
Insr	A	T	8: 3,192,572	I49N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lnpep	A	G	17: 17,553,192	M639T	probably benign	Het
Map3k20	C	T	2: 72,410,159	S333F	probably damaging	Het
Miga2	A	G	2: 30,371,217	S175G	probably benign	Het
Muc3a	A	T	5: 137,210,122	I191N	probably damaging	Het
Ncoa2	A	G	1: 13,174,371	V701A	probably damaging	Het
Nid2	T	C	14: 19,778,783	V565A	probably damaging	Het
Nova2	G	A	7: 18,957,869	A244T	unknown	Het
Numbl	G	C	7: 27,281,314	A574P	probably damaging	Het
Oas3	A	G	5: 120,769,048	V508A	unknown	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Pcdhb21	T	A	18: 37,514,408	S197T	probably benign	Het
Pck2	T	A	14: 55,543,962	M180K	probably damaging	Het
Pgr	T	C	9: 8,900,739	V91A	possibly damaging	Het
Phtf1	A	T	3: 104,004,405	M643L	probably damaging	Het
Prokr1	T	C	6: 87,588,855	T3A	possibly damaging	Het
Ptgs1	T	C	2: 36,251,178	Y546H	probably damaging	Het
Rasa1	A	G	13: 85,226,626	L742P	probably benign	Het
Rbbp6	T	C	7: 122,997,311		probably null	Het
Rnf213	A	T	11: 119,411,470	I407F	probably damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
RP24-388A6.3	A	T	5: 16,824,685	D473V	probably damaging	Het
Scin	G	A	12: 40,060,579	P690L	probably damaging	Het
Sept9	T	C	11: 117,352,161	L58P	probably damaging	Het
Slc1a7	A	G	4: 108,012,436	E566G	probably damaging	Het
Speer4f1	G	A	5: 17,476,142	R6Q	probably benign	Het
Tnxb	A	T	17: 34,672,012	Y443F	probably damaging	Het
Trpv1	A	G	11: 73,244,317	I79V	probably benign	Het
Ttll6	C	T	11: 96,139,742	T245I	possibly damaging	Het
Vmn2r26	T	C	6: 124,061,485	I673T	probably damaging	Het
Zfp60	T	C	7: 27,749,898	F664L	probably benign	Het

Other mutations in Rgs22

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Rgs22	APN	15	36099931	missense	possibly damaging	0.93
IGL00594:Rgs22	APN	15	36083631	missense	probably benign	0.00
IGL01464:Rgs22	APN	15	36083641	missense	possibly damaging	0.90
IGL01686:Rgs22	APN	15	36103835	missense	probably benign	0.00
IGL01761:Rgs22	APN	15	36103751	missense	probably damaging	0.99
IGL02045:Rgs22	APN	15	36013154	missense	probably benign	0.33
IGL02378:Rgs22	APN	15	36103805	missense	probably benign	0.00
IGL02490:Rgs22	APN	15	36054847	missense	probably damaging	1.00
IGL03219:Rgs22	APN	15	36107048	missense	probably damaging	1.00
IGL03229:Rgs22	APN	15	36015779	splice site	probably benign
IGL03328:Rgs22	APN	15	36043204	critical splice donor site	probably null
3-1:Rgs22	UTSW	15	36100036	missense	possibly damaging	0.48
R0254:Rgs22	UTSW	15	36104552	missense	probably damaging	0.99
R0463:Rgs22	UTSW	15	36092938	missense	probably damaging	1.00
R0467:Rgs22	UTSW	15	36099795	nonsense	probably null
R0486:Rgs22	UTSW	15	36092882	missense	probably damaging	0.98
R0554:Rgs22	UTSW	15	36054709	missense	probably benign	0.10
R0602:Rgs22	UTSW	15	36139872	splice site	probably benign
R0906:Rgs22	UTSW	15	36103902	intron	probably benign
R1159:Rgs22	UTSW	15	36040693	missense	probably damaging	1.00
R1300:Rgs22	UTSW	15	36101762	missense	probably benign	0.43
R1439:Rgs22	UTSW	15	36025793	splice site	probably benign
R1491:Rgs22	UTSW	15	36092901	missense	probably damaging	0.98
R1502:Rgs22	UTSW	15	36080851	missense	probably damaging	1.00
R1514:Rgs22	UTSW	15	36013100	missense	probably benign	0.00
R1538:Rgs22	UTSW	15	36048776	missense	probably damaging	1.00
R1784:Rgs22	UTSW	15	36087436	missense	probably damaging	1.00
R1938:Rgs22	UTSW	15	36101804	missense	probably benign	0.00
R1972:Rgs22	UTSW	15	36103836	missense	probably benign	0.01
R2109:Rgs22	UTSW	15	36099734	nonsense	probably null
R2208:Rgs22	UTSW	15	36050232	missense	probably benign	0.01
R3696:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3697:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3698:Rgs22	UTSW	15	36099892	missense	probably benign	0.00
R3879:Rgs22	UTSW	15	36106905	missense	possibly damaging	0.52
R4080:Rgs22	UTSW	15	36107076	missense	probably damaging	1.00
R4363:Rgs22	UTSW	15	36103874	missense	probably damaging	0.99
R4591:Rgs22	UTSW	15	36100136	missense	probably benign	0.01
R4673:Rgs22	UTSW	15	36099933	missense	probably benign	0.04
R4829:Rgs22	UTSW	15	36103888	missense	probably damaging	1.00
R4831:Rgs22	UTSW	15	36050148	missense	probably benign	0.00
R4865:Rgs22	UTSW	15	36100212	missense	probably damaging	1.00
R4907:Rgs22	UTSW	15	36087424	missense	possibly damaging	0.61
R4944:Rgs22	UTSW	15	36025942	missense	possibly damaging	0.83
R4975:Rgs22	UTSW	15	36054876	nonsense	probably null
R5056:Rgs22	UTSW	15	36050245	splice site	probably null
R5126:Rgs22	UTSW	15	36040644	missense	probably damaging	0.96
R5138:Rgs22	UTSW	15	36099788	missense	probably benign	0.04
R5444:Rgs22	UTSW	15	36015627	missense	possibly damaging	0.83
R5507:Rgs22	UTSW	15	36099652	missense	probably damaging	0.99
R5640:Rgs22	UTSW	15	36106955	missense	probably benign	0.00
R5969:Rgs22	UTSW	15	36015636	missense	probably benign	0.00
R6005:Rgs22	UTSW	15	36010567	missense	probably benign	0.39
R6053:Rgs22	UTSW	15	36100007	missense	probably benign	0.04
R6230:Rgs22	UTSW	15	36100030	missense	probably benign	0.02
R6295:Rgs22	UTSW	15	36087374	missense	probably benign	0.00
R6352:Rgs22	UTSW	15	36092921	missense	probably damaging	1.00
R6809:Rgs22	UTSW	15	36048764	missense	probably damaging	1.00
R6900:Rgs22	UTSW	15	36010747	missense	possibly damaging	0.61
R6947:Rgs22	UTSW	15	36103890	critical splice acceptor site	probably null
R7102:Rgs22	UTSW	15	36122313	missense	probably damaging	1.00
R7126:Rgs22	UTSW	15	36103808	missense	probably damaging	0.97
R7263:Rgs22	UTSW	15	36015643	missense	possibly damaging	0.86
R7623:Rgs22	UTSW	15	36040710	missense	probably benign	0.08
R7732:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R7748:Rgs22	UTSW	15	36122269	critical splice donor site	probably null
R7771:Rgs22	UTSW	15	36050078	missense	possibly damaging	0.94
R7835:Rgs22	UTSW	15	36081911	critical splice donor site	probably null
R7849:Rgs22	UTSW	15	36099712	missense	probably damaging	1.00
R7954:Rgs22	UTSW	15	36082002	missense	possibly damaging	0.75
R8384:Rgs22	UTSW	15	36046012	critical splice donor site	probably null
R8516:Rgs22	UTSW	15	36010335	makesense	probably null
R8904:Rgs22	UTSW	15	36025981	missense	probably damaging	1.00
R8923:Rgs22	UTSW	15	36092960	missense	probably damaging	1.00
R9287:Rgs22	UTSW	15	36098263	missense	probably damaging	1.00
R9324:Rgs22	UTSW	15	36087398	missense	probably benign
RF035:Rgs22	UTSW	15	36010835	critical splice acceptor site	probably benign
RF043:Rgs22	UTSW	15	36010836	critical splice acceptor site	probably benign

Predicted Primers

PCR Primer
(F):5'- TCTTAAATGACACTCCAAGCCG -3'
(R):5'- AAGGAAGACTTCACTGGACCCC -3'

Sequencing Primer
(F):5'- GCCGGCTTACCATGATGCTG -3'
(R):5'- TCCAGCCAAGGAGTTTCCAAAATC -3'

Posted On

2017-10-10