Mutagenetix > Incidental Mutation

Incidental Mutation 'R6134:Afg3l2'

487309

Institutional Source

Beutler Lab

Gene Symbol

Afg3l2

Ensembl Gene

ENSMUSG00000024527

Gene Name

AFG3-like AAA ATPase 2

Synonyms

2310036I02Rik, Emv66, par

MMRRC Submission

044281-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6134 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

67404767-67449166 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 67421259 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Methionine at position 458 (L458M)

Ref Sequence

ENSEMBL: ENSMUSP00000025408 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025408]

AlphaFold

Q8JZQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000025408
AA Change: L458M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025408
Gene: ENSMUSG00000024527
AA Change: L458M

Domain	Start	End	E-Value	Type
low complexity region	95	121	N/A	INTRINSIC
Pfam:FtsH_ext	144	241	8.8e-12	PFAM
transmembrane domain	251	270	N/A	INTRINSIC
low complexity region	271	286	N/A	INTRINSIC
AAA	339	478	1.37e-23	SMART
Pfam:Peptidase_M41	540	743	4e-77	PFAM
low complexity region	780	794	N/A	INTRINSIC

Meta Mutation Damage Score

0.3865

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

94% (51/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein localized in mitochondria and closely related to paraplegin. The paraplegin gene is responsible for an autosomal recessive form of hereditary spastic paraplegia. This gene is a candidate gene for other hereditary spastic paraplegias or neurodegenerative disorders. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutations in this gene usually die before weaning. Mice develop progressive paralysis as a result of abnormalities in the axons innervating muscle endplates. Mice homozygous for a conditional allele activated in Purkinje cells exhibit abnormal gait and Purkinje cell degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	G	A	11: 58,876,793	E39K	probably damaging	Het
Aktip	T	A	8: 91,129,760	S30C	probably damaging	Het
Anxa10	G	T	8: 62,077,943	H78N	probably damaging	Het
Aoah	C	T	13: 20,911,123	R196W	probably damaging	Het
Arl4c	A	T	1: 88,701,430	W79R	probably damaging	Het
Brd2	A	T	17: 34,113,695	D178E	probably benign	Het
Cacna1e	G	A	1: 154,701,291	P120L	probably damaging	Het
Cdh16	A	T	8: 104,616,065	M17K	probably benign	Het
Chit1	A	G	1: 134,144,060	T103A	possibly damaging	Het
Clcn3	T	C	8: 60,934,573	Y214C	probably damaging	Het
Coch	T	A	12: 51,602,753	D282E	probably damaging	Het
Col1a2	C	A	6: 4,538,035	S1181R	unknown	Het
Col6a2	T	C	10: 76,607,144	D506G	probably damaging	Het
Crx	A	T	7: 15,868,107	Y215*	probably null	Het
Fam160a1	T	C	3: 85,673,344	E518G	possibly damaging	Het
Fasn	A	T	11: 120,822,186	S58T	probably benign	Het
Garem1	A	T	18: 21,129,824	D644E	probably benign	Het
Gm4763	G	A	7: 24,726,056	A3V	probably damaging	Het
H2-Q2	A	C	17: 35,343,241	T155P	probably damaging	Het
Insr	A	T	8: 3,192,572	I49N	probably damaging	Het
Itgb4	C	T	11: 115,984,157	R447W	probably benign	Het
Lnpep	A	G	17: 17,553,192	M639T	probably benign	Het
Map3k20	C	T	2: 72,410,159	S333F	probably damaging	Het
Miga2	A	G	2: 30,371,217	S175G	probably benign	Het
Muc3a	A	T	5: 137,210,122	I191N	probably damaging	Het
Ncoa2	A	G	1: 13,174,371	V701A	probably damaging	Het
Nid2	T	C	14: 19,778,783	V565A	probably damaging	Het
Nova2	G	A	7: 18,957,869	A244T	unknown	Het
Numbl	G	C	7: 27,281,314	A574P	probably damaging	Het
Oas3	A	G	5: 120,769,048	V508A	unknown	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
Otx1	A	T	11: 21,999,406	L24H	probably damaging	Het
Pcdhb21	T	A	18: 37,514,408	S197T	probably benign	Het
Pck2	T	A	14: 55,543,962	M180K	probably damaging	Het
Pgr	T	C	9: 8,900,739	V91A	possibly damaging	Het
Phtf1	A	T	3: 104,004,405	M643L	probably damaging	Het
Prokr1	T	C	6: 87,588,855	T3A	possibly damaging	Het
Ptgs1	T	C	2: 36,251,178	Y546H	probably damaging	Het
Rasa1	A	G	13: 85,226,626	L742P	probably benign	Het
Rbbp6	T	C	7: 122,997,311		probably null	Het
Rgs22	A	G	15: 36,107,048	L64P	probably damaging	Het
Rnf213	A	T	11: 119,411,470	I407F	probably damaging	Het
Rp1l1	C	T	14: 64,030,096	P1044S	probably damaging	Het
RP24-388A6.3	A	T	5: 16,824,685	D473V	probably damaging	Het
Scin	G	A	12: 40,060,579	P690L	probably damaging	Het
Sept9	T	C	11: 117,352,161	L58P	probably damaging	Het
Slc1a7	A	G	4: 108,012,436	E566G	probably damaging	Het
Speer4f1	G	A	5: 17,476,142	R6Q	probably benign	Het
Tnxb	A	T	17: 34,672,012	Y443F	probably damaging	Het
Trpv1	A	G	11: 73,244,317	I79V	probably benign	Het
Ttll6	C	T	11: 96,139,742	T245I	possibly damaging	Het
Vmn2r26	T	C	6: 124,061,485	I673T	probably damaging	Het
Zfp60	T	C	7: 27,749,898	F664L	probably benign	Het

Other mutations in Afg3l2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00962:Afg3l2	APN	18	67431653	critical splice donor site	probably null
IGL01395:Afg3l2	APN	18	67442810	missense	probably benign	0.21
IGL01533:Afg3l2	APN	18	67405418	nonsense	probably null
IGL01814:Afg3l2	APN	18	67405474	missense	probably benign	0.23
IGL01868:Afg3l2	APN	18	67414148	missense	possibly damaging	0.83
IGL02399:Afg3l2	APN	18	67429040	missense	possibly damaging	0.82
IGL02827:Afg3l2	APN	18	67425945	missense	probably damaging	1.00
IGL03342:Afg3l2	APN	18	67407320	missense	probably benign
IGL03392:Afg3l2	APN	18	67414069	splice site	probably benign
radicle	UTSW	18	67422953	missense	probably damaging	1.00
rootlet	UTSW	18	67421259	missense	probably damaging	1.00
R0057:Afg3l2	UTSW	18	67423086	missense	probably damaging	1.00
R0107:Afg3l2	UTSW	18	67431766	missense	probably damaging	1.00
R0650:Afg3l2	UTSW	18	67415557	missense	possibly damaging	0.77
R0831:Afg3l2	UTSW	18	67421227	missense	probably damaging	1.00
R0899:Afg3l2	UTSW	18	67422977	missense	possibly damaging	0.65
R0962:Afg3l2	UTSW	18	67405427	missense	possibly damaging	0.77
R1672:Afg3l2	UTSW	18	67407423	missense	probably benign	0.31
R1815:Afg3l2	UTSW	18	67415573	nonsense	probably null
R1838:Afg3l2	UTSW	18	67414172	missense	probably damaging	0.99
R2013:Afg3l2	UTSW	18	67431772	missense	probably damaging	0.99
R2383:Afg3l2	UTSW	18	67422956	missense	possibly damaging	0.91
R2906:Afg3l2	UTSW	18	67440222	missense	probably damaging	1.00
R4763:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4765:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R4775:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5193:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5196:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5197:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5257:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5361:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5362:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5363:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5397:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5588:Afg3l2	UTSW	18	67440207	missense	possibly damaging	0.88
R5605:Afg3l2	UTSW	18	67442355	nonsense	probably null
R5696:Afg3l2	UTSW	18	67407459	missense	probably damaging	1.00
R5722:Afg3l2	UTSW	18	67440199	missense	probably benign	0.44
R5779:Afg3l2	UTSW	18	67440443	missense	probably null	0.12
R5972:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5973:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5974:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5979:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R5994:Afg3l2	UTSW	18	67429070	missense	probably damaging	1.00
R6026:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6027:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6028:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6029:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6033:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6035:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6075:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6077:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6081:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6131:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6132:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6152:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6154:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6169:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6178:Afg3l2	UTSW	18	67409528	missense	possibly damaging	0.91
R6187:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6216:Afg3l2	UTSW	18	67421259	missense	probably damaging	1.00
R6718:Afg3l2	UTSW	18	67421276	missense	probably damaging	1.00
R7388:Afg3l2	UTSW	18	67422953	missense	probably damaging	1.00
R8479:Afg3l2	UTSW	18	67448916	missense	probably benign	0.05
R8531:Afg3l2	UTSW	18	67407369	missense	probably damaging	0.99
R9017:Afg3l2	UTSW	18	67409480	missense	possibly damaging	0.81
R9220:Afg3l2	UTSW	18	67429196	missense	probably benign
R9222:Afg3l2	UTSW	18	67434187	missense	probably benign	0.05
R9371:Afg3l2	UTSW	18	67434192	missense	possibly damaging	0.84
R9381:Afg3l2	UTSW	18	67442381	missense	probably damaging	1.00
R9562:Afg3l2	UTSW	18	67421295	missense	probably damaging	1.00
Z1176:Afg3l2	UTSW	18	67431707	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCACTGTCCAGCTTCAATGG -3'
(R):5'- AGTTTACATCTTGATTGTAGCTCCC -3'

Sequencing Primer
(F):5'- TCCAGCTTCAATGGTCGAAG -3'
(R):5'- GATTGTAGCTCCCCTCTCCAG -3'

Posted On

2017-10-10