Incidental Mutation 'R6125:Mdm4'
ID 487315
Institutional Source Beutler Lab
Gene Symbol Mdm4
Ensembl Gene ENSMUSG00000054387
Gene Name transformed mouse 3T3 cell double minute 4
Synonyms 4933417N07Rik, Mdmx
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6125 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 132959484-133030561 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 132994510 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 298 (T298I)
Ref Sequence ENSEMBL: ENSMUSP00000140812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067398] [ENSMUST00000067429] [ENSMUST00000185398] [ENSMUST00000186617] [ENSMUST00000188090] [ENSMUST00000191212]
AlphaFold O35618
Predicted Effect possibly damaging
Transcript: ENSMUST00000067398
AA Change: T299I

PolyPhen 2 Score 0.938 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000068661
Gene: ENSMUSG00000054387
AA Change: T299I

DomainStartEndE-ValueType
Pfam:SWIB 26 96 3.7e-10 PFAM
low complexity region 281 295 N/A INTRINSIC
ZnF_RBZ 302 326 1.65e-2 SMART
RING 437 477 7.26e-1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067429
AA Change: T298I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000070411
Gene: ENSMUSG00000054387
AA Change: T298I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185398
SMART Domains Protein: ENSMUSP00000140090
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.8e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186513
Predicted Effect possibly damaging
Transcript: ENSMUST00000186617
AA Change: T298I

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000140812
Gene: ENSMUSG00000054387
AA Change: T298I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 9.9e-15 PFAM
low complexity region 280 294 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000188090
AA Change: T298I

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140609
Gene: ENSMUSG00000054387
AA Change: T298I

DomainStartEndE-ValueType
Pfam:SWIB 26 101 2.5e-17 PFAM
low complexity region 280 294 N/A INTRINSIC
ZnF_RBZ 301 325 1.65e-2 SMART
RING 436 476 7.26e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189596
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190312
Predicted Effect probably benign
Transcript: ENSMUST00000191212
SMART Domains Protein: ENSMUSP00000140006
Gene: ENSMUSG00000054387

DomainStartEndE-ValueType
Pfam:SWIB 27 102 1.4e-15 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: This gene encodes a protein that has been shown to negatively regulate the activity of the tumor suppressor protein p53. Homozygous knockout mice exhibit embryonic lethality as a result of p53-dependent apoptosis and cell cycle arrest. Amplification of this gene or overexpression of the encoded protein has been linked to a range of human cancers. A pseudogene has been identified on the X chromosome. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit embryonic lethality, decreased cellular proliferation, and abnormal nervous system development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dlgap2 A T 8: 14,727,193 H146L possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Fstl4 T C 11: 53,186,303 M629T probably benign Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Rgs2 T C 1: 144,004,025 K32E probably damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Mdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01778:Mdm4 APN 1 132994547 missense probably benign 0.02
IGL03034:Mdm4 APN 1 133011071 missense probably damaging 1.00
IGL03099:Mdm4 APN 1 132992209 missense probably damaging 1.00
Isla_nublar UTSW 1 133012692 missense probably damaging 1.00
Jurassic UTSW 1 133011115 missense probably damaging 0.96
Sun_island UTSW 1 133012651 missense probably damaging 1.00
R0630:Mdm4 UTSW 1 132991753 missense possibly damaging 0.47
R1170:Mdm4 UTSW 1 132991820 missense probably damaging 1.00
R1170:Mdm4 UTSW 1 133012692 missense probably damaging 1.00
R1774:Mdm4 UTSW 1 132996646 missense probably damaging 0.99
R1920:Mdm4 UTSW 1 133003800 missense probably benign 0.06
R2061:Mdm4 UTSW 1 133012651 missense probably damaging 1.00
R2212:Mdm4 UTSW 1 132994522 missense probably damaging 1.00
R3695:Mdm4 UTSW 1 132991993 missense probably benign 0.00
R3919:Mdm4 UTSW 1 132994568 missense possibly damaging 0.94
R5273:Mdm4 UTSW 1 132994582 missense probably benign
R5360:Mdm4 UTSW 1 132991658 makesense probably null
R6153:Mdm4 UTSW 1 132992107 missense probably damaging 1.00
R7028:Mdm4 UTSW 1 133003809 missense probably benign 0.09
R7234:Mdm4 UTSW 1 133011115 missense probably damaging 0.96
R7267:Mdm4 UTSW 1 132994573 missense probably benign 0.00
R8831:Mdm4 UTSW 1 133003863 missense probably benign 0.01
R8932:Mdm4 UTSW 1 133012644 missense probably benign 0.13
R8941:Mdm4 UTSW 1 132991933 missense probably benign 0.00
R9272:Mdm4 UTSW 1 133001431 missense possibly damaging 0.82
R9279:Mdm4 UTSW 1 132996678 missense probably damaging 1.00
R9356:Mdm4 UTSW 1 133011099 missense probably damaging 1.00
Z1088:Mdm4 UTSW 1 132994547 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TTGTGTTAGCAGGGACAGATAG -3'
(R):5'- AAGGTATTTAGTAGCCCTGTGG -3'

Sequencing Primer
(F):5'- TTTAATCCCAGCACTCGGGAG -3'
(R):5'- ATTTAGTAGCCCTGTGGTTTTTAAG -3'
Posted On 2017-10-10