Incidental Mutation 'R6125:Rgs2'
ID487316
Institutional Source Beutler Lab
Gene Symbol Rgs2
Ensembl Gene ENSMUSG00000026360
Gene Nameregulator of G-protein signaling 2
SynonymsGOS8
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R6125 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location143999338-144004161 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144004025 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 32 (K32E)
Ref Sequence ENSEMBL: ENSMUSP00000139964 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027606] [ENSMUST00000127206] [ENSMUST00000153527]
Predicted Effect probably damaging
Transcript: ENSMUST00000027606
AA Change: K32E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect possibly damaging
Transcript: ENSMUST00000127206
AA Change: K32E

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000115558
Gene: ENSMUSG00000026360
AA Change: K32E

DomainStartEndE-ValueType
RGS 83 199 4.5e-54 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134817
Predicted Effect probably benign
Transcript: ENSMUST00000153527
SMART Domains Protein: ENSMUSP00000140548
Gene: ENSMUSG00000026360

DomainStartEndE-ValueType
RGS 51 130 1.6e-11 SMART
Meta Mutation Damage Score 0.4905 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Regulator of G protein signaling (RGS) family members are regulatory molecules that act as GTPase activating proteins (GAPs) for G alpha subunits of heterotrimeric G proteins. RGS proteins are able to deactivate G protein subunits of the Gi alpha, Go alpha and Gq alpha subtypes. They drive G proteins into their inactive GDP-bound forms. Regulator of G protein signaling 2 belongs to this family. The protein acts as a mediator of myeloid differentiation and may play a role in leukemogenesis. [provided by RefSeq, Aug 2009]
PHENOTYPE: Heterozygous and homozygous mice for one allele display equivalent levels of blood pressure elevation, renovascular defects, persistent constriction of the resistance vasculature, and prolonged response of the vasculature to vasoconstrictors in vivo. Mice homozygous for another allele appear normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dlgap2 A T 8: 14,727,193 H146L possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Fstl4 T C 11: 53,186,303 M629T probably benign Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mdm4 G A 1: 132,994,510 T298I possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Rgs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Rgs2 APN 1 144002229 missense probably damaging 1.00
R0189:Rgs2 UTSW 1 144002284 critical splice acceptor site probably null
R0866:Rgs2 UTSW 1 144002250 missense probably damaging 1.00
R2041:Rgs2 UTSW 1 144002222 missense probably damaging 1.00
R4005:Rgs2 UTSW 1 144001868 missense probably benign 0.01
R4654:Rgs2 UTSW 1 144002912 intron probably benign
R5144:Rgs2 UTSW 1 144001699 missense probably benign 0.00
R7180:Rgs2 UTSW 1 144002148 missense probably benign 0.04
R8831:Rgs2 UTSW 1 144001759 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTAAACTCTCGGAGCTCAC -3'
(R):5'- AGTGCCTACCAAATCTCTCTGTG -3'

Sequencing Primer
(F):5'- TACCACCATATCTAGCAAGCTAAC -3'
(R):5'- TCTGCAGCGAGCCAATC -3'
Posted On2017-10-10