Mutagenetix > Incidental Mutation

Incidental Mutation 'R6125:Atp1a1'

487326

Institutional Source

Beutler Lab

Gene Symbol

Atp1a1

Ensembl Gene

ENSMUSG00000033161

Gene Name

ATPase, Na+/K+ transporting, alpha 1 polypeptide

Synonyms

Atpa-1

MMRRC Submission

044272-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6125 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

101576219-101604684 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 101590707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 255 (R255C)

Ref Sequence

ENSEMBL: ENSMUSP00000039657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036493]

AlphaFold

Q8VDN2

Predicted Effect

probably damaging
Transcript: ENSMUST00000036493
AA Change: R255C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000039657
Gene: ENSMUSG00000033161
AA Change: R255C

Domain	Start	End	E-Value	Type
low complexity region	21	28	N/A	INTRINSIC
Cation_ATPase_N	42	116	5e-20	SMART
Pfam:E1-E2_ATPase	134	365	1.6e-59	PFAM
Pfam:Hydrolase	370	729	2.7e-19	PFAM
Pfam:HAD	373	726	1.3e-18	PFAM
Pfam:Cation_ATPase	426	521	2.2e-25	PFAM
Pfam:Cation_ATPase_C	799	1008	1.2e-46	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000136340

Meta Mutation Damage Score

0.8721

Coding Region Coverage

1x: 99.9%
3x: 99.4%
10x: 97.3%
20x: 91.5%

Validation Efficiency

97% (65/67)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 1 subunit. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene have a lethal phenotype. Heterozygotes display increased anxiety and decreased exploratory behavior in a new environment. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arhgef11	T	C	3: 87,729,602	F1023S	probably damaging	Het
Bbs12	A	G	3: 37,320,551	I383V	probably benign	Het
BC067074	A	G	13: 113,317,683	T88A	probably benign	Het
Cacna1h	G	A	17: 25,385,694	P1215L	probably benign	Het
Calm5	A	T	13: 3,854,491	K62*	probably null	Het
Chd8	T	A	14: 52,207,034	H398L	probably benign	Het
Dlgap2	A	T	8: 14,727,193	H146L	possibly damaging	Het
Dopey1	G	A	9: 86,521,133	R1462H	probably damaging	Het
Dupd1	C	A	14: 21,686,690	V115L	probably benign	Het
Dync2h1	T	C	9: 7,168,706	N369S	probably damaging	Het
Fam84b	T	C	15: 60,823,297	N200S	probably damaging	Het
Fer1l4	A	C	2: 156,046,987	V422G	probably damaging	Het
Fstl4	T	C	11: 53,186,303	M629T	probably benign	Het
Galnt18	A	G	7: 111,485,193	Y507H	probably damaging	Het
Gar1	C	A	3: 129,830,750		probably benign	Het
Gm19402	T	C	10: 77,690,673	T29A	probably damaging	Het
Gm826	A	G	2: 160,327,114	F92L	unknown	Het
H1f0	T	A	15: 79,028,870	I50N	probably damaging	Het
H2-DMb1	A	G	17: 34,157,465	Y186C	probably damaging	Het
Hgf	A	G	5: 16,598,161	N357S	probably damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Hsf2	T	C	10: 57,512,005	V415A	probably benign	Het
Ins2	C	A	7: 142,679,693		probably null	Het
Kel	A	T	6: 41,690,786	F89L	probably damaging	Het
Lrrc37a	T	C	11: 103,501,560	D1013G	probably benign	Het
Ltbp4	C	A	7: 27,327,755	G397C	probably damaging	Het
Madd	A	G	2: 91,152,452		probably null	Het
Map4k4	A	G	1: 40,003,965	D660G	possibly damaging	Het
Mdm4	G	A	1: 132,994,510	T298I	possibly damaging	Het
Mlip	G	A	9: 77,230,482	S381L	probably damaging	Het
Mpdz	A	T	4: 81,297,527	C1487S	probably benign	Het
Mtus1	A	G	8: 41,084,539	S47P	probably damaging	Het
Nek1	T	C	8: 61,028,701	S217P	probably damaging	Het
Olfr1129	T	C	2: 87,575,246	I54T	probably benign	Het
Olfr1487	C	T	19: 13,619,885	A241V	probably benign	Het
Pcdhb10	T	C	18: 37,413,626	V585A	possibly damaging	Het
Perm1	A	G	4: 156,217,719	E240G	probably benign	Het
Pkdrej	T	C	15: 85,816,384	T1784A	probably damaging	Het
Pnpla8	C	T	12: 44,307,989	T644M	possibly damaging	Het
Rgs2	T	C	1: 144,004,025	K32E	probably damaging	Het
Scyl3	A	T	1: 163,950,576	M428L	probably benign	Het
Slc30a8	A	G	15: 52,335,134	D325G	probably benign	Het
Slc5a9	G	T	4: 111,883,805	T548K	probably damaging	Het
Slc9b2	G	A	3: 135,330,696		probably null	Het
Slco3a1	C	T	7: 74,318,506	D489N	probably benign	Het
Slit3	T	C	11: 35,570,733		probably null	Het
Stk39	C	A	2: 68,392,124	G199C	probably damaging	Het
Tbx1	A	G	16: 18,583,466	F263L	probably damaging	Het
Tcf21	G	T	10: 22,819,766	N46K	probably benign	Het
Tdrd9	T	A	12: 112,068,198	M1357K	possibly damaging	Het
Tll1	A	G	8: 64,051,487	L625P	probably damaging	Het
Tmem131	G	A	1: 36,808,306	S1237L	possibly damaging	Het
Trdv5	T	C	14: 54,148,841	K56E	possibly damaging	Het
Triml2	G	A	8: 43,187,622	V172I	probably benign	Het
Trmt44	C	A	5: 35,565,498	D409Y	probably damaging	Het
Ube2o	T	C	11: 116,544,750	D404G	possibly damaging	Het
Ube2o	C	T	11: 116,541,378	A921T	probably damaging	Het
Ube4b	T	C	4: 149,398,746	T22A	probably benign	Het
Ugp2	A	T	11: 21,329,815	F327L	probably damaging	Het
Virma	T	C	4: 11,521,172	S910P	probably damaging	Het
Vmn2r9	A	G	5: 108,842,970	Y842H	probably benign	Het
Zfhx4	A	G	3: 5,398,811	D1368G	possibly damaging	Het
Zfp980	T	A	4: 145,702,638	*646R	probably null	Het
Zranb3	T	A	1: 127,959,745	N982Y	probably benign	Het

Other mutations in Atp1a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01396:Atp1a1	APN	3	101591453	missense	probably damaging	1.00
IGL01700:Atp1a1	APN	3	101594258	missense	possibly damaging	0.95
IGL01836:Atp1a1	APN	3	101591414	missense	probably damaging	1.00
IGL01863:Atp1a1	APN	3	101591889	nonsense	probably null
IGL02021:Atp1a1	APN	3	101594208	missense	probably benign	0.02
IGL02078:Atp1a1	APN	3	101591863	missense	probably damaging	1.00
IGL02873:Atp1a1	APN	3	101576578	missense	probably benign	0.16
IGL02934:Atp1a1	APN	3	101576992	nonsense	probably null
IGL03068:Atp1a1	APN	3	101583859	missense	probably benign	0.26
PIT4453001:Atp1a1	UTSW	3	101581179	missense	probably benign	0.01
R0009:Atp1a1	UTSW	3	101579835	missense	possibly damaging	0.67
R0506:Atp1a1	UTSW	3	101589812	missense	probably damaging	0.96
R0724:Atp1a1	UTSW	3	101592439	missense	possibly damaging	0.50
R0826:Atp1a1	UTSW	3	101584853	missense	probably damaging	0.99
R1457:Atp1a1	UTSW	3	101590466	missense	probably damaging	1.00
R1732:Atp1a1	UTSW	3	101584799	missense	probably damaging	1.00
R1843:Atp1a1	UTSW	3	101582017	missense	probably benign	0.43
R2172:Atp1a1	UTSW	3	101590548	missense	probably benign
R3770:Atp1a1	UTSW	3	101581194	missense	probably benign	0.17
R3905:Atp1a1	UTSW	3	101590612	missense	probably benign	0.00
R4602:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4611:Atp1a1	UTSW	3	101586943	missense	probably benign	0.00
R4715:Atp1a1	UTSW	3	101591806	missense	possibly damaging	0.90
R4777:Atp1a1	UTSW	3	101594996	critical splice donor site	probably null
R4795:Atp1a1	UTSW	3	101583775	missense	probably benign	0.15
R5030:Atp1a1	UTSW	3	101579817	missense	probably benign	0.22
R5066:Atp1a1	UTSW	3	101582104	missense	probably damaging	0.98
R5165:Atp1a1	UTSW	3	101581789	missense	probably benign	0.01
R5297:Atp1a1	UTSW	3	101591127	missense	possibly damaging	0.82
R5307:Atp1a1	UTSW	3	101589964	missense	probably damaging	1.00
R5379:Atp1a1	UTSW	3	101582095	missense	probably benign	0.01
R5495:Atp1a1	UTSW	3	101591425	missense	probably benign	0.01
R5946:Atp1a1	UTSW	3	101589774	missense	probably benign	0.12
R6789:Atp1a1	UTSW	3	101586298	missense	possibly damaging	0.71
R7339:Atp1a1	UTSW	3	101589872	missense	probably benign	0.44
R7552:Atp1a1	UTSW	3	101582121	nonsense	probably null
R7825:Atp1a1	UTSW	3	101586169	missense	probably benign	0.00
R8098:Atp1a1	UTSW	3	101582049	missense	probably damaging	0.97
R8175:Atp1a1	UTSW	3	101584854	missense	possibly damaging	0.79
R8281:Atp1a1	UTSW	3	101579624	missense	probably benign	0.12
R8403:Atp1a1	UTSW	3	101586904	missense	probably damaging	1.00
R8435:Atp1a1	UTSW	3	101582762	missense	probably benign
R8461:Atp1a1	UTSW	3	101589089	missense	probably benign	0.01
R8772:Atp1a1	UTSW	3	101579808	missense	probably benign
R8782:Atp1a1	UTSW	3	101594217	missense	possibly damaging	0.63
R8919:Atp1a1	UTSW	3	101591231	missense	probably damaging	1.00
R9066:Atp1a1	UTSW	3	101582022	missense	probably damaging	1.00
R9227:Atp1a1	UTSW	3	101592434	missense	probably damaging	1.00
R9712:Atp1a1	UTSW	3	101591441	missense	probably benign	0.06
X0019:Atp1a1	UTSW	3	101594213	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GTTGGCTACGATGATACCAATGAG -3'
(R):5'- TACCAGTGCTGTCACCAGAC -3'

Sequencing Primer
(F):5'- TCGAGCCAGGTGTACTCAAG -3'
(R):5'- AGTGCTGTCACCAGACTCTGC -3'

Posted On

2017-10-10