Incidental Mutation 'R6125:Dlgap2'
ID 487341
Institutional Source Beutler Lab
Gene Symbol Dlgap2
Ensembl Gene ENSMUSG00000047495
Gene Name DLG associated protein 2
Synonyms PSD-95/SAP90-binding protein 2, DAP2, Sapap2, 6430596N04Rik, SAP90/PSD-95-associated protein 2
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6125 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 14095865-14847680 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 14727193 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 146 (H146L)
Ref Sequence ENSEMBL: ENSMUSP00000123078 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043279] [ENSMUST00000133298] [ENSMUST00000150247] [ENSMUST00000152652]
AlphaFold Q8BJ42
Predicted Effect probably benign
Transcript: ENSMUST00000043279
AA Change: H145L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000039647
Gene: ENSMUSG00000047495
AA Change: H145L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133298
AA Change: H145L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000119613
Gene: ENSMUSG00000047495
AA Change: H145L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1059 1.5e-151 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141214
Predicted Effect probably benign
Transcript: ENSMUST00000150247
AA Change: H145L

PolyPhen 2 Score 0.117 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123104
Gene: ENSMUSG00000047495
AA Change: H145L

DomainStartEndE-ValueType
low complexity region 269 294 N/A INTRINSIC
low complexity region 297 310 N/A INTRINSIC
low complexity region 446 456 N/A INTRINSIC
low complexity region 543 556 N/A INTRINSIC
low complexity region 614 628 N/A INTRINSIC
Pfam:GKAP 707 1045 1e-151 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000152652
AA Change: H146L

PolyPhen 2 Score 0.781 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123078
Gene: ENSMUSG00000047495
AA Change: H146L

DomainStartEndE-ValueType
low complexity region 270 295 N/A INTRINSIC
low complexity region 298 311 N/A INTRINSIC
low complexity region 447 457 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 615 629 N/A INTRINSIC
Pfam:GKAP 715 1060 1.9e-160 PFAM
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a membrane-associated protein that may play a role in synapse organization and signalling in neuronal cells. This gene is biallelically expressed in the brain, however, only the paternal allele is expressed in the testis (PMID:18055845). Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jun 2014]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Fstl4 T C 11: 53,186,303 M629T probably benign Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mdm4 G A 1: 132,994,510 T298I possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Rgs2 T C 1: 144,004,025 K32E probably damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Dlgap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Dlgap2 APN 8 14778301 nonsense probably null
IGL01788:Dlgap2 APN 8 14843631 missense probably benign 0.19
IGL02054:Dlgap2 APN 8 14843552 missense probably damaging 0.98
IGL02969:Dlgap2 APN 8 14831579 missense possibly damaging 0.95
IGL03183:Dlgap2 APN 8 14727525 missense possibly damaging 0.62
IGL03303:Dlgap2 APN 8 14727812 missense probably damaging 0.99
G1Funyon:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
PIT4403001:Dlgap2 UTSW 8 14831528 missense probably damaging 1.00
R0026:Dlgap2 UTSW 8 14727363 nonsense probably null
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0242:Dlgap2 UTSW 8 14727562 missense probably benign 0.34
R0647:Dlgap2 UTSW 8 14727591 missense possibly damaging 0.95
R1221:Dlgap2 UTSW 8 14726952 missense probably benign 0.08
R1374:Dlgap2 UTSW 8 14831228 splice site probably benign
R1440:Dlgap2 UTSW 8 14727060 missense probably benign
R1544:Dlgap2 UTSW 8 14829861 splice site probably null
R1550:Dlgap2 UTSW 8 14822499 missense probably damaging 0.98
R1804:Dlgap2 UTSW 8 14727809 missense possibly damaging 0.71
R1870:Dlgap2 UTSW 8 14773347 missense probably damaging 1.00
R1921:Dlgap2 UTSW 8 14843624 missense probably benign 0.10
R2119:Dlgap2 UTSW 8 14778206 missense possibly damaging 0.69
R2193:Dlgap2 UTSW 8 14743431 missense possibly damaging 0.51
R4381:Dlgap2 UTSW 8 14846502 missense probably benign
R4422:Dlgap2 UTSW 8 14743463 critical splice donor site probably null
R4521:Dlgap2 UTSW 8 14727871 missense probably damaging 1.00
R4581:Dlgap2 UTSW 8 14846679 missense probably damaging 1.00
R4585:Dlgap2 UTSW 8 14727999 critical splice donor site probably null
R4760:Dlgap2 UTSW 8 14773380 missense probably damaging 1.00
R5077:Dlgap2 UTSW 8 14822691 missense probably benign 0.35
R5373:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5374:Dlgap2 UTSW 8 14823614 missense probably benign 0.19
R5552:Dlgap2 UTSW 8 14831342 nonsense probably null
R5964:Dlgap2 UTSW 8 14727128 nonsense probably null
R6147:Dlgap2 UTSW 8 14727294 missense probably benign 0.05
R6163:Dlgap2 UTSW 8 14846641 missense probably damaging 1.00
R6269:Dlgap2 UTSW 8 14822369 missense probably benign 0.01
R6629:Dlgap2 UTSW 8 14831465 missense probably benign 0.00
R6765:Dlgap2 UTSW 8 14743284 missense probably benign 0.00
R6809:Dlgap2 UTSW 8 14179619 intron probably benign
R6913:Dlgap2 UTSW 8 14778374 missense probably benign 0.10
R7219:Dlgap2 UTSW 8 14743296 missense probably benign 0.00
R7485:Dlgap2 UTSW 8 14829952 missense probably damaging 0.97
R7560:Dlgap2 UTSW 8 14822697 critical splice donor site probably null
R7826:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R7976:Dlgap2 UTSW 8 14743410 missense probably benign 0.38
R8101:Dlgap2 UTSW 8 14831600 missense probably benign 0.04
R8301:Dlgap2 UTSW 8 14823577 missense probably benign 0.27
R8333:Dlgap2 UTSW 8 14778295 missense probably benign 0.03
R8367:Dlgap2 UTSW 8 14843544 missense probably benign 0.00
R8492:Dlgap2 UTSW 8 14778271 missense possibly damaging 0.49
R8685:Dlgap2 UTSW 8 14831628 missense possibly damaging 0.71
R8690:Dlgap2 UTSW 8 14743430 missense probably benign 0.00
R8887:Dlgap2 UTSW 8 14179682 critical splice donor site probably null
R9328:Dlgap2 UTSW 8 14727441 missense probably damaging 1.00
R9338:Dlgap2 UTSW 8 14179683 critical splice donor site probably null
R9465:Dlgap2 UTSW 8 14778226 missense probably damaging 1.00
R9680:Dlgap2 UTSW 8 14846653 missense probably damaging 0.98
X0060:Dlgap2 UTSW 8 14839787 missense probably damaging 1.00
Z1088:Dlgap2 UTSW 8 14822472 missense probably benign 0.10
Z1177:Dlgap2 UTSW 8 14727659 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCAGCACTTCAATGAAGAG -3'
(R):5'- GGGAGCTGTTTCTCAAACTGG -3'

Sequencing Primer
(F):5'- CAGCACTTCAATGAAGAGAGGTAC -3'
(R):5'- CTCAAACTGGTCTAAGAGGTTGGC -3'
Posted On 2017-10-10