Mutagenetix > Incidental Mutations

Incidental Mutation 'R0523:Dicer1'

48735

Institutional Source

Beutler Lab

Gene Symbol

Dicer1

Ensembl Gene

ENSMUSG00000041415

Gene Name

dicer 1, ribonuclease type III

Synonyms

D12Ertd7e

MMRRC Submission

038716-MU

Accession Numbers

Ncbi RefSeq: NM_148948.2; MGI:2177178

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R0523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

104687742-104751952 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 104702491 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1311 (S1311P)

Ref Sequence

ENSEMBL: ENSMUSP00000043676 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041987]

Predicted Effect

probably damaging
Transcript: ENSMUST00000041987
AA Change: S1311P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000043676
Gene: ENSMUSG00000041415
AA Change: S1311P

Domain	Start	End	E-Value	Type
DEXDc	30	233	5.14e-24	SMART
low complexity region	403	419	N/A	INTRINSIC
HELICc	449	546	3.15e-10	SMART
Pfam:Dicer_dimer	620	707	1.4e-25	PFAM
low complexity region	713	723	N/A	INTRINSIC
PAZ	881	1056	1.67e-48	SMART
Blast:PAZ	1080	1129	2e-8	BLAST
RIBOc	1285	1582	1.83e-35	SMART
RIBOc	1665	1831	5.97e-49	SMART
DSRM	1834	1897	6.89e-9	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222115

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222519

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222528

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

MGI Phenotype

Strain: 3589209; 3809262; 2681012; 3576927
Lethality: E7-E14
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein possessing an RNA helicase motif containing a DEXH box in its amino terminus and an RNA motif in the carboxy terminus. The encoded protein functions as a ribonuclease and is required by the RNA interference and small temporal RNA (stRNA) pathways to produce the active small RNA component that represses gene expression. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mutation of this locus results in arrest of early embryonic development. [provided by MGI curators]

Allele List at MGI

All alleles(25) : Targeted(14) Gene trapped(11)

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,644,629	M1K	probably null	Het
2410089E03Rik	T	A	15: 8,194,386	Y878N	probably damaging	Het
A2ml1	T	C	6: 128,558,326	D807G	possibly damaging	Het
Actl9	T	A	17: 33,433,349	W128R	probably damaging	Het
Aggf1	T	C	13: 95,356,416	I562V	probably damaging	Het
Ano3	T	A	2: 110,884,855	E79D	probably benign	Het
Apobec1	T	A	6: 122,581,545	I84F	probably damaging	Het
Atp6v1b2	T	C	8: 69,109,985	F458L	possibly damaging	Het
BC051142	G	T	17: 34,445,499		probably null	Het
Bco2	A	T	9: 50,534,626	V490E	probably damaging	Het
Catsperg1	G	A	7: 29,185,190		probably benign	Het
Cdc37	T	C	9: 21,142,996	K111R	probably damaging	Het
Cfap54	T	C	10: 92,908,883		probably benign	Het
Cpox	T	A	16: 58,675,245	C308*	probably null	Het
Ctnna3	T	G	10: 64,675,909	M626R	probably damaging	Het
Cyp2c68	T	C	19: 39,739,429	E93G	probably benign	Het
Cyp2s1	G	A	7: 25,806,050	R330W	probably damaging	Het
Diaph1	C	T	18: 37,856,500	V860I	possibly damaging	Het
Dpyd	G	A	3: 118,899,203	R332K	probably benign	Het
E130308A19Rik	G	A	4: 59,719,716	R416H	probably damaging	Het
Eef1d	T	C	15: 75,903,156	D218G	probably benign	Het
Eif2ak1	T	C	5: 143,882,166	V215A	probably damaging	Het
Eif2ak4	T	C	2: 118,442,096		probably null	Het
Fam71e2	A	G	7: 4,759,393	S246P	possibly damaging	Het
Fcrl5	T	C	3: 87,457,792	S583P	possibly damaging	Het
Grid2ip	C	A	5: 143,373,043	Q29K	possibly damaging	Het
Htr1f	A	T	16: 64,925,899	N343K	probably damaging	Het
Hvcn1	T	C	5: 122,216,365		probably null	Het
Igf2r	T	C	17: 12,692,064	I1956V	probably benign	Het
Impdh2	A	T	9: 108,561,819		probably null	Het
Impdh2	C	T	9: 108,561,820	T96I	possibly damaging	Het
Lactb	C	G	9: 66,970,692	G285A	probably benign	Het
Lrrc43	T	C	5: 123,501,242	S445P	probably damaging	Het
Maats1	G	A	16: 38,328,374	P231S	probably damaging	Het
Mapk12	T	G	15: 89,135,645	M120L	probably benign	Het
Mroh8	C	G	2: 157,224,036	A669P	probably damaging	Het
Mrpl38	A	C	11: 116,132,018	H373Q	probably benign	Het
Myocd	A	G	11: 65,180,902	V740A	probably damaging	Het
Naprt	A	G	15: 75,892,465	F300S	probably damaging	Het
Ncam2	T	C	16: 81,461,643	I271T	probably damaging	Het
Nek4	A	G	14: 30,980,038	T582A	probably benign	Het
Notch2	C	T	3: 98,070,970	T89I	probably benign	Het
Notch2	G	A	3: 98,111,598	R692H	probably benign	Het
Nt5c3	A	T	6: 56,883,681	N296K	probably damaging	Het
Nt5c3b	T	A	11: 100,436,210	I87F	probably damaging	Het
Oas3	T	C	5: 120,766,144	Q555R	unknown	Het
Olfr1013	T	A	2: 85,769,929	S43T	probably benign	Het
Olfr494	A	T	7: 108,368,231	H247L	probably damaging	Het
Olfr699	A	G	7: 106,790,326	V225A	probably damaging	Het
P3h1	C	A	4: 119,241,530	Q410K	probably benign	Het
Pax3	A	G	1: 78,195,441	V44A	possibly damaging	Het
Pde1c	T	A	6: 56,174,941	L252F	probably damaging	Het
Pdzd7	T	A	19: 45,036,090	T497S	probably benign	Het
Piezo2	T	C	18: 63,022,481	T253A	probably damaging	Het
Pipox	T	C	11: 77,892,139	E79G	probably damaging	Het
Pole	G	T	5: 110,303,593	M829I	probably damaging	Het
Ppp1r12c	A	T	7: 4,489,772	L156Q	probably damaging	Het
Psme2b	T	G	11: 48,945,782	T113P	probably damaging	Het
Ptprq	A	G	10: 107,580,220	I1739T	possibly damaging	Het
Qser1	T	C	2: 104,789,676	T174A	probably damaging	Het
Rcor3	T	G	1: 192,130,436	D81A	probably damaging	Het
Rev3l	T	C	10: 39,848,049	V785A	probably benign	Het
Rnf11	T	C	4: 109,456,922	D90G	probably benign	Het
Sh3tc1	GCCTCCTCCTCCTCCTCC	GCCTCCTCCTCCTCC	5: 35,724,066		probably benign	Het
Smad2	T	A	18: 76,262,552	S21T	probably benign	Het
Smc4	A	G	3: 69,025,888	D639G	probably damaging	Het
Smtn	A	T	11: 3,524,664	S716T	possibly damaging	Het
Smug1	G	T	15: 103,155,709	Q262K	probably benign	Het
Sspo	G	T	6: 48,451,860	G403V	probably benign	Het
Tas2r131	A	G	6: 132,957,451	F132L	possibly damaging	Het
Tgm3	T	C	2: 130,044,662		probably null	Het
Tigd2	C	T	6: 59,210,373	T75M	probably benign	Het
Tnfrsf13b	T	C	11: 61,147,587	V232A	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim47	A	G	11: 116,107,890	L301S	probably damaging	Het
Trim75	G	A	8: 64,983,790	H3Y	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Ttc29	G	C	8: 78,276,837	L227F	probably benign	Het
Ttc39d	G	A	17: 80,216,457	D182N	possibly damaging	Het
Ttll10	T	A	4: 156,045,361	R164*	probably null	Het
Ufsp2	T	A	8: 45,996,743	D447E	probably benign	Het
Ugt2b37	T	A	5: 87,251,832	L272F	possibly damaging	Het
Vps13b	T	C	15: 35,472,050	V833A	probably benign	Het
Zbbx	T	C	3: 75,081,858	T308A	probably benign	Het
Zfp933	G	A	4: 147,826,462	Q226*	probably null	Het

Other mutations in Dicer1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Dicer1	APN	12	104696772	missense	possibly damaging	0.93
IGL01061:Dicer1	APN	12	104706327	missense	probably null	0.75
IGL01527:Dicer1	APN	12	104691610	nonsense	probably null
IGL01597:Dicer1	APN	12	104705210	nonsense	probably null
IGL01636:Dicer1	APN	12	104722241	missense	probably damaging	1.00
IGL01717:Dicer1	APN	12	104702787	nonsense	probably null
IGL01765:Dicer1	APN	12	104706740	missense	probably damaging	1.00
IGL01871:Dicer1	APN	12	104704180	missense	probably damaging	1.00
IGL02316:Dicer1	APN	12	104702553	missense	probably damaging	1.00
IGL02317:Dicer1	APN	12	104697020	missense	probably damaging	1.00
IGL02539:Dicer1	APN	12	104697035	missense	probably damaging	0.97
IGL02544:Dicer1	APN	12	104714832	missense	probably damaging	1.00
IGL02664:Dicer1	APN	12	104705129	missense	probably damaging	1.00
IGL02667:Dicer1	APN	12	104714906	missense	probably damaging	1.00
IGL03353:Dicer1	APN	12	104713107	missense	probably damaging	1.00
IGL03377:Dicer1	APN	12	104712197	missense	probably damaging	0.98
everest	UTSW	12	104705128	missense	probably damaging	1.00
PIT4480001:Dicer1	UTSW	12	104696544	missense	probably benign
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0032:Dicer1	UTSW	12	104704798	nonsense	probably null
R0219:Dicer1	UTSW	12	104692125	critical splice donor site	probably null
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0242:Dicer1	UTSW	12	104702451	missense	probably benign	0.02
R0385:Dicer1	UTSW	12	104704174	missense	probably damaging	1.00
R0402:Dicer1	UTSW	12	104731064	missense	probably benign	0.04
R0426:Dicer1	UTSW	12	104702542	missense	probably damaging	1.00
R0453:Dicer1	UTSW	12	104702630	missense	probably benign
R0502:Dicer1	UTSW	12	104705060	missense	probably damaging	1.00
R0507:Dicer1	UTSW	12	104691658	missense	probably damaging	1.00
R0511:Dicer1	UTSW	12	104702841	missense	possibly damaging	0.95
R0559:Dicer1	UTSW	12	104706301	missense	probably damaging	1.00
R0600:Dicer1	UTSW	12	104706864	missense	probably damaging	1.00
R0707:Dicer1	UTSW	12	104706885	missense	probably damaging	1.00
R1225:Dicer1	UTSW	12	104691607	missense	probably damaging	0.98
R1351:Dicer1	UTSW	12	104729142	missense	probably damaging	0.99
R1449:Dicer1	UTSW	12	104729243	missense	possibly damaging	0.85
R1575:Dicer1	UTSW	12	104721969	critical splice donor site	probably null
R1642:Dicer1	UTSW	12	104713156	missense	probably damaging	1.00
R1651:Dicer1	UTSW	12	104708805	missense	probably damaging	1.00
R1658:Dicer1	UTSW	12	104700414	missense	probably benign
R1815:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1816:Dicer1	UTSW	12	104722151	missense	probably damaging	1.00
R1927:Dicer1	UTSW	12	104702884	missense	possibly damaging	0.91
R2113:Dicer1	UTSW	12	104713214	missense	probably damaging	1.00
R2129:Dicer1	UTSW	12	104722031	missense	probably damaging	1.00
R2157:Dicer1	UTSW	12	104702949	missense	probably benign	0.17
R2202:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2203:Dicer1	UTSW	12	104731038	missense	probably damaging	0.98
R2243:Dicer1	UTSW	12	104730188	missense	probably damaging	0.99
R4237:Dicer1	UTSW	12	104729228	missense	possibly damaging	0.48
R4419:Dicer1	UTSW	12	104705114	missense	probably damaging	1.00
R4482:Dicer1	UTSW	12	104706277	missense	probably damaging	1.00
R4564:Dicer1	UTSW	12	104704751	nonsense	probably null
R4776:Dicer1	UTSW	12	104692446	missense	probably damaging	0.99
R4834:Dicer1	UTSW	12	104696591	missense	probably benign	0.44
R4904:Dicer1	UTSW	12	104713066	missense	probably benign
R5202:Dicer1	UTSW	12	104694731	nonsense	probably null
R5272:Dicer1	UTSW	12	104704240	missense	probably damaging	1.00
R5363:Dicer1	UTSW	12	104703151	missense	probably damaging	1.00
R5717:Dicer1	UTSW	12	104705128	missense	probably damaging	1.00
R6381:Dicer1	UTSW	12	104696462	missense	probably benign	0.00
R6479:Dicer1	UTSW	12	104696723	missense	probably damaging	0.97
R6956:Dicer1	UTSW	12	104731023	missense	probably damaging	1.00
R7234:Dicer1	UTSW	12	104708849	missense	probably damaging	1.00
R7401:Dicer1	UTSW	12	104712278	missense	probably benign
R7407:Dicer1	UTSW	12	104722351	nonsense	probably null
R7471:Dicer1	UTSW	12	104694710	missense	probably damaging	1.00
R7699:Dicer1	UTSW	12	104705170	missense	probably damaging	1.00
R7768:Dicer1	UTSW	12	104706697	missense	probably damaging	0.99
R7831:Dicer1	UTSW	12	104708800	missense	probably damaging	1.00
R7998:Dicer1	UTSW	12	104704069	missense	probably damaging	1.00
R8010:Dicer1	UTSW	12	104692132	missense	probably damaging	0.99
R8061:Dicer1	UTSW	12	104702818	nonsense	probably null
R8213:Dicer1	UTSW	12	104702693	missense	probably benign	0.00
R8261:Dicer1	UTSW	12	104691606	missense	probably damaging	1.00
R8419:Dicer1	UTSW	12	104702677	missense	probably benign	0.00
X0018:Dicer1	UTSW	12	104696934	missense	probably benign	0.00
Z1176:Dicer1	UTSW	12	104731020	missense	probably null	0.97

Predicted Primers

PCR Primer
(F):5'- ACTTGGCCTGTTTTCAGGCACAC -3'
(R):5'- AAGCCCAGCAATGAATGTCCTCTAC -3'

Sequencing Primer
(F):5'- TTTCAGGCACACTGAAGAAGC -3'
(R):5'- TACCTTGATGGGAACGCTAAC -3'

Posted On

2013-06-12