Incidental Mutation 'R6125:Fstl4'
ID487354
Institutional Source Beutler Lab
Gene Symbol Fstl4
Ensembl Gene ENSMUSG00000036264
Gene Namefollistatin-like 4
SynonymsSPIG1, B230374F23Rik
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R6125 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location52764634-53188538 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 53186303 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 629 (M629T)
Ref Sequence ENSEMBL: ENSMUSP00000042007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036796]
Predicted Effect probably benign
Transcript: ENSMUST00000036796
AA Change: M629T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042007
Gene: ENSMUSG00000036264
AA Change: M629T

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
KAZAL 87 132 4.7e-13 SMART
Blast:IG_like 215 241 6e-7 BLAST
IGc2 260 327 1.9e-6 SMART
IGc2 352 419 1e-14 SMART
Meta Mutation Damage Score 0.0636 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
MGI Phenotype PHENOTYPE: Homozygous null mice were born at expected Mendelian ratio and healthy, fertile, apparently normal with normal retinal laminar structure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dlgap2 A T 8: 14,727,193 H146L possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mdm4 G A 1: 132,994,510 T298I possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pkdrej T C 15: 85,816,384 T1784A probably damaging Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Rgs2 T C 1: 144,004,025 K32E probably damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Fstl4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Fstl4 APN 11 53186275 missense probably benign 0.01
IGL00885:Fstl4 APN 11 53148982 missense possibly damaging 0.90
IGL00915:Fstl4 APN 11 53176998 missense probably benign
IGL00933:Fstl4 APN 11 53186761 missense possibly damaging 0.80
IGL01022:Fstl4 APN 11 53186741 missense probably benign 0.18
IGL01121:Fstl4 APN 11 52814637 missense probably benign 0.00
IGL01656:Fstl4 APN 11 53000374 missense probably damaging 1.00
IGL01805:Fstl4 APN 11 53186357 missense probably damaging 1.00
IGL01997:Fstl4 APN 11 53163054 nonsense probably null
IGL02386:Fstl4 APN 11 52773871 missense probably benign 0.21
IGL02536:Fstl4 APN 11 53134024 splice site probably benign
IGL02807:Fstl4 APN 11 53186674 missense probably benign 0.03
IGL03037:Fstl4 APN 11 53168223 missense possibly damaging 0.83
R0462:Fstl4 UTSW 11 53186402 missense probably benign 0.09
R1190:Fstl4 UTSW 11 53068546 missense probably benign
R1300:Fstl4 UTSW 11 53068627 missense probably benign
R1626:Fstl4 UTSW 11 53000290 nonsense probably null
R1695:Fstl4 UTSW 11 53165878 splice site probably null
R1699:Fstl4 UTSW 11 53168178 missense possibly damaging 0.81
R1727:Fstl4 UTSW 11 53068651 missense probably damaging 1.00
R1752:Fstl4 UTSW 11 53186795 missense probably benign 0.09
R1866:Fstl4 UTSW 11 53186398 missense probably benign 0.00
R4689:Fstl4 UTSW 11 53068650 nonsense probably null
R5126:Fstl4 UTSW 11 53186561 missense possibly damaging 0.71
R5129:Fstl4 UTSW 11 53186439 missense probably damaging 1.00
R5499:Fstl4 UTSW 11 53068547 missense probably benign 0.01
R5578:Fstl4 UTSW 11 53165781 missense probably damaging 1.00
R5715:Fstl4 UTSW 11 53000416 missense possibly damaging 0.53
R6177:Fstl4 UTSW 11 53168204 missense probably benign 0.00
R6236:Fstl4 UTSW 11 53186335 missense probably benign 0.00
R6311:Fstl4 UTSW 11 53176977 missense probably damaging 1.00
R6611:Fstl4 UTSW 11 53186725 missense probably benign 0.01
R6886:Fstl4 UTSW 11 53186450 missense probably damaging 1.00
R7404:Fstl4 UTSW 11 53134071 missense probably benign 0.03
R7423:Fstl4 UTSW 11 53068555 missense possibly damaging 0.54
R7586:Fstl4 UTSW 11 53072429 missense probably benign 0.00
R7756:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7758:Fstl4 UTSW 11 53168296 missense possibly damaging 0.69
R7775:Fstl4 UTSW 11 53176971 nonsense probably null
R7953:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8026:Fstl4 UTSW 11 53068669 missense probably damaging 0.99
R8043:Fstl4 UTSW 11 53000223 missense probably benign 0.01
R8375:Fstl4 UTSW 11 53162675 missense possibly damaging 0.63
R8866:Fstl4 UTSW 11 53072406 missense possibly damaging 0.54
X0013:Fstl4 UTSW 11 53162619 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTGACTTCTGGACGCATTC -3'
(R):5'- GATATCACTGTTGGGGCCTAG -3'

Sequencing Primer
(F):5'- GCATTCCCTGCCAAATGATAG -3'
(R):5'- TAGCACCGAGTCTGTGACACTG -3'
Posted On2017-10-10