Incidental Mutation 'R0523:Aggf1'
ID48736
Institutional Source Beutler Lab
Gene Symbol Aggf1
Ensembl Gene ENSMUSG00000021681
Gene Nameangiogenic factor with G patch and FHA domains 1
Synonyms2010009L17Rik, 2310029P06Rik, VG5Q
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.851) question?
Stock #R0523 (G1)
Quality Score209
Status Not validated
Chromosome13
Chromosomal Location95350683-95375352 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 95356416 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 562 (I562V)
Ref Sequence ENSEMBL: ENSMUSP00000022189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022189]
Predicted Effect probably damaging
Transcript: ENSMUST00000022189
AA Change: I562V

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000022189
Gene: ENSMUSG00000021681
AA Change: I562V

DomainStartEndE-ValueType
coiled coil region 20 85 N/A INTRINSIC
low complexity region 128 137 N/A INTRINSIC
low complexity region 184 201 N/A INTRINSIC
internal_repeat_1 205 225 4.68e-9 PROSPERO
internal_repeat_1 221 241 4.68e-9 PROSPERO
low complexity region 270 280 N/A INTRINSIC
low complexity region 356 370 N/A INTRINSIC
low complexity region 380 401 N/A INTRINSIC
FHA 430 484 1.51e-9 SMART
low complexity region 548 561 N/A INTRINSIC
G_patch 614 660 1.31e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161671
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an angiogenic factor that promotes proliferation of endothelial cells. Mutations in this gene are associated with a susceptibility to Klippel-Trenaunay syndrome. Pseudogenes of this gene are found on chromosomes 3, 4, 10 and 16.[provided by RefSeq, Sep 2010]
PHENOTYPE: Homozygous null embryos die before E8.5. Heterozygotes exhibit defective angiogenesis in yolk sacs and embryos and partial lethality. Surviving adults show hemorrhages, increased vascular permeability, and reduced tumor growth of implanted melanoma cell lines. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
BC051142 G T 17: 34,445,499 probably null Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in Aggf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00835:Aggf1 APN 13 95362477 missense probably damaging 1.00
IGL01083:Aggf1 APN 13 95356409 missense probably damaging 1.00
IGL01296:Aggf1 APN 13 95353971 missense probably damaging 1.00
IGL01811:Aggf1 APN 13 95351572 missense probably benign 0.04
IGL02089:Aggf1 APN 13 95370929 missense probably benign 0.22
IGL02351:Aggf1 APN 13 95352850 splice site probably benign
IGL02358:Aggf1 APN 13 95352850 splice site probably benign
IGL02534:Aggf1 APN 13 95369522 missense possibly damaging 0.76
PIT4687001:Aggf1 UTSW 13 95364875 missense probably damaging 0.99
R0090:Aggf1 UTSW 13 95364959 missense probably benign 0.01
R0189:Aggf1 UTSW 13 95356480 splice site probably benign
R0332:Aggf1 UTSW 13 95369446 missense probably damaging 1.00
R0334:Aggf1 UTSW 13 95371597 missense probably benign 0.02
R0445:Aggf1 UTSW 13 95354001 missense possibly damaging 0.74
R0575:Aggf1 UTSW 13 95368397 missense probably benign 0.02
R0647:Aggf1 UTSW 13 95371656 splice site probably null
R1401:Aggf1 UTSW 13 95364848 missense probably benign 0.02
R1495:Aggf1 UTSW 13 95356413 nonsense probably null
R1542:Aggf1 UTSW 13 95370942 missense probably benign 0.00
R1688:Aggf1 UTSW 13 95364767 missense probably damaging 1.00
R2225:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R2226:Aggf1 UTSW 13 95370846 missense probably damaging 0.96
R4405:Aggf1 UTSW 13 95371594 missense probably benign 0.00
R4764:Aggf1 UTSW 13 95364713 missense probably damaging 0.96
R5819:Aggf1 UTSW 13 95351621 missense possibly damaging 0.76
R5878:Aggf1 UTSW 13 95369557 missense probably benign 0.18
R5946:Aggf1 UTSW 13 95371576 missense probably damaging 1.00
R6056:Aggf1 UTSW 13 95371615 missense probably benign 0.00
R6823:Aggf1 UTSW 13 95364723 missense probably benign 0.11
R7051:Aggf1 UTSW 13 95351617 missense possibly damaging 0.94
R7638:Aggf1 UTSW 13 95356413 nonsense probably null
R7682:Aggf1 UTSW 13 95368426 missense probably benign 0.41
R7903:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
R7986:Aggf1 UTSW 13 95356458 missense probably damaging 1.00
RF014:Aggf1 UTSW 13 95370768 missense possibly damaging 0.87
X0010:Aggf1 UTSW 13 95364977 missense probably benign
X0064:Aggf1 UTSW 13 95362870 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGTCCTCCACTTTGGTTTCTGAGAG -3'
(R):5'- CCCCACAAATGTTAGCCCCATGTTAC -3'

Sequencing Primer
(F):5'- tctgagagggggctaactg -3'
(R):5'- tttccccccttcctccc -3'
Posted On2013-06-12