Incidental Mutation 'R6125:Pkdrej'
ID487368
Institutional Source Beutler Lab
Gene Symbol Pkdrej
Ensembl Gene ENSMUSG00000052496
Gene Namepolycystin (PKD) family receptor for egg jelly
Synonyms
MMRRC Submission 044272-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6125 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location85814670-85821734 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85816384 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1784 (T1784A)
Ref Sequence ENSEMBL: ENSMUSP00000086352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064370] [ENSMUST00000071876] [ENSMUST00000134631] [ENSMUST00000144067] [ENSMUST00000150995] [ENSMUST00000154814]
Predicted Effect probably damaging
Transcript: ENSMUST00000064370
AA Change: T1784A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086352
Gene: ENSMUSG00000052496
AA Change: T1784A

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Pfam:REJ 130 598 6.2e-116 PFAM
coiled coil region 657 687 N/A INTRINSIC
low complexity region 942 947 N/A INTRINSIC
GPS 984 1050 1.37e-2 SMART
transmembrane domain 1067 1089 N/A INTRINSIC
LH2 1114 1230 3.35e-6 SMART
transmembrane domain 1274 1292 N/A INTRINSIC
transmembrane domain 1312 1334 N/A INTRINSIC
low complexity region 1407 1415 N/A INTRINSIC
transmembrane domain 1451 1473 N/A INTRINSIC
transmembrane domain 1483 1505 N/A INTRINSIC
low complexity region 1571 1579 N/A INTRINSIC
transmembrane domain 1581 1603 N/A INTRINSIC
Pfam:PKD_channel 1621 2051 5.2e-154 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071876
SMART Domains Protein: ENSMUSP00000071772
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 106 3.2e-41 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134631
SMART Domains Protein: ENSMUSP00000121889
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144067
SMART Domains Protein: ENSMUSP00000119728
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150995
SMART Domains Protein: ENSMUSP00000123174
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 109 1.6e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154814
SMART Domains Protein: ENSMUSP00000116823
Gene: ENSMUSG00000064284

DomainStartEndE-ValueType
Pfam:C6_DPF 13 78 1e-35 PFAM
Meta Mutation Damage Score 0.6612 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.3%
  • 20x: 91.5%
Validation Efficiency 97% (65/67)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene encodes a member of the polycystin protein family. The encoded protein contains 11 transmembrane domains, a receptor for egg jelly (REJ) domain, a G-protein-coupled receptor proteolytic site (GPS) domain, and a polycystin-1, lipoxygenase, alpha-toxin (PLAT) domain. This protein may play a role in human reproduction. Alternative splice variants have been described but their biological natures have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null males are fertile in unrestricted mating trials but show lower reproductive success in sequential mating and artificial insemination trials. Although mutant sperm are able to capacitate in vitro, they acquire exocytotic competence at a slower rate than wild-type sperm. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef11 T C 3: 87,729,602 F1023S probably damaging Het
Atp1a1 G A 3: 101,590,707 R255C probably damaging Het
Bbs12 A G 3: 37,320,551 I383V probably benign Het
BC067074 A G 13: 113,317,683 T88A probably benign Het
Cacna1h G A 17: 25,385,694 P1215L probably benign Het
Calm5 A T 13: 3,854,491 K62* probably null Het
Chd8 T A 14: 52,207,034 H398L probably benign Het
Dlgap2 A T 8: 14,727,193 H146L possibly damaging Het
Dopey1 G A 9: 86,521,133 R1462H probably damaging Het
Dupd1 C A 14: 21,686,690 V115L probably benign Het
Dync2h1 T C 9: 7,168,706 N369S probably damaging Het
Fam84b T C 15: 60,823,297 N200S probably damaging Het
Fer1l4 A C 2: 156,046,987 V422G probably damaging Het
Fstl4 T C 11: 53,186,303 M629T probably benign Het
Galnt18 A G 7: 111,485,193 Y507H probably damaging Het
Gar1 C A 3: 129,830,750 probably benign Het
Gm19402 T C 10: 77,690,673 T29A probably damaging Het
Gm826 A G 2: 160,327,114 F92L unknown Het
H1f0 T A 15: 79,028,870 I50N probably damaging Het
H2-DMb1 A G 17: 34,157,465 Y186C probably damaging Het
Hgf A G 5: 16,598,161 N357S probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hsf2 T C 10: 57,512,005 V415A probably benign Het
Ins2 C A 7: 142,679,693 probably null Het
Kel A T 6: 41,690,786 F89L probably damaging Het
Lrrc37a T C 11: 103,501,560 D1013G probably benign Het
Ltbp4 C A 7: 27,327,755 G397C probably damaging Het
Madd A G 2: 91,152,452 probably null Het
Map4k4 A G 1: 40,003,965 D660G possibly damaging Het
Mdm4 G A 1: 132,994,510 T298I possibly damaging Het
Mlip G A 9: 77,230,482 S381L probably damaging Het
Mpdz A T 4: 81,297,527 C1487S probably benign Het
Mtus1 A G 8: 41,084,539 S47P probably damaging Het
Nek1 T C 8: 61,028,701 S217P probably damaging Het
Olfr1129 T C 2: 87,575,246 I54T probably benign Het
Olfr1487 C T 19: 13,619,885 A241V probably benign Het
Pcdhb10 T C 18: 37,413,626 V585A possibly damaging Het
Perm1 A G 4: 156,217,719 E240G probably benign Het
Pnpla8 C T 12: 44,307,989 T644M possibly damaging Het
Rgs2 T C 1: 144,004,025 K32E probably damaging Het
Scyl3 A T 1: 163,950,576 M428L probably benign Het
Slc30a8 A G 15: 52,335,134 D325G probably benign Het
Slc5a9 G T 4: 111,883,805 T548K probably damaging Het
Slc9b2 G A 3: 135,330,696 probably null Het
Slco3a1 C T 7: 74,318,506 D489N probably benign Het
Slit3 T C 11: 35,570,733 probably null Het
Stk39 C A 2: 68,392,124 G199C probably damaging Het
Tbx1 A G 16: 18,583,466 F263L probably damaging Het
Tcf21 G T 10: 22,819,766 N46K probably benign Het
Tdrd9 T A 12: 112,068,198 M1357K possibly damaging Het
Tll1 A G 8: 64,051,487 L625P probably damaging Het
Tmem131 G A 1: 36,808,306 S1237L possibly damaging Het
Trdv5 T C 14: 54,148,841 K56E possibly damaging Het
Triml2 G A 8: 43,187,622 V172I probably benign Het
Trmt44 C A 5: 35,565,498 D409Y probably damaging Het
Ube2o C T 11: 116,541,378 A921T probably damaging Het
Ube2o T C 11: 116,544,750 D404G possibly damaging Het
Ube4b T C 4: 149,398,746 T22A probably benign Het
Ugp2 A T 11: 21,329,815 F327L probably damaging Het
Virma T C 4: 11,521,172 S910P probably damaging Het
Vmn2r9 A G 5: 108,842,970 Y842H probably benign Het
Zfhx4 A G 3: 5,398,811 D1368G possibly damaging Het
Zfp980 T A 4: 145,702,638 *646R probably null Het
Zranb3 T A 1: 127,959,745 N982Y probably benign Het
Other mutations in Pkdrej
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00921:Pkdrej APN 15 85817226 missense probably damaging 1.00
IGL00981:Pkdrej APN 15 85819656 missense probably damaging 1.00
IGL01066:Pkdrej APN 15 85816159 missense probably benign 0.22
IGL01461:Pkdrej APN 15 85820374 missense possibly damaging 0.77
IGL01514:Pkdrej APN 15 85818063 missense possibly damaging 0.82
IGL01606:Pkdrej APN 15 85817700 missense possibly damaging 0.67
IGL01836:Pkdrej APN 15 85820958 missense probably damaging 1.00
IGL02089:Pkdrej APN 15 85816288 missense possibly damaging 0.87
IGL02197:Pkdrej APN 15 85815793 missense possibly damaging 0.89
IGL02331:Pkdrej APN 15 85821327 missense probably damaging 1.00
IGL02559:Pkdrej APN 15 85817848 missense probably benign
IGL02708:Pkdrej APN 15 85820787 missense probably damaging 1.00
IGL02739:Pkdrej APN 15 85819694 missense probably benign 0.41
IGL02741:Pkdrej APN 15 85817430 missense probably benign 0.04
IGL02882:Pkdrej APN 15 85817296 missense probably damaging 1.00
IGL02968:Pkdrej APN 15 85816181 nonsense probably null
IGL03250:Pkdrej APN 15 85821355 missense possibly damaging 0.92
FR4548:Pkdrej UTSW 15 85819680 small insertion probably benign
FR4737:Pkdrej UTSW 15 85819680 small insertion probably benign
PIT1430001:Pkdrej UTSW 15 85821292 missense probably damaging 0.99
PIT4280001:Pkdrej UTSW 15 85819935 missense probably benign 0.01
R0004:Pkdrej UTSW 15 85818183 missense probably damaging 1.00
R0116:Pkdrej UTSW 15 85817545 nonsense probably null
R0117:Pkdrej UTSW 15 85816099 unclassified probably null
R0137:Pkdrej UTSW 15 85821567 missense possibly damaging 0.95
R0141:Pkdrej UTSW 15 85815630 missense probably damaging 0.99
R0325:Pkdrej UTSW 15 85819551 missense probably benign 0.08
R0714:Pkdrej UTSW 15 85815511 missense possibly damaging 0.85
R0749:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0750:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R0755:Pkdrej UTSW 15 85816135 missense probably benign 0.00
R0938:Pkdrej UTSW 15 85818163 missense probably damaging 1.00
R1126:Pkdrej UTSW 15 85816314 missense probably damaging 0.99
R1204:Pkdrej UTSW 15 85818312 missense probably damaging 1.00
R1353:Pkdrej UTSW 15 85818918 missense probably damaging 1.00
R1471:Pkdrej UTSW 15 85817133 missense probably benign 0.37
R1510:Pkdrej UTSW 15 85816762 missense possibly damaging 0.61
R1573:Pkdrej UTSW 15 85818074 missense probably benign 0.43
R1588:Pkdrej UTSW 15 85817241 missense probably benign 0.44
R1739:Pkdrej UTSW 15 85820427 missense probably benign 0.03
R1779:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1781:Pkdrej UTSW 15 85821171 missense possibly damaging 0.83
R1828:Pkdrej UTSW 15 85819282 missense possibly damaging 0.48
R1865:Pkdrej UTSW 15 85820324 nonsense probably null
R1870:Pkdrej UTSW 15 85816431 missense probably damaging 1.00
R1937:Pkdrej UTSW 15 85819167 missense probably benign 0.00
R2069:Pkdrej UTSW 15 85821231 missense probably benign 0.01
R2113:Pkdrej UTSW 15 85818984 missense probably damaging 1.00
R2135:Pkdrej UTSW 15 85816506 missense probably damaging 1.00
R2428:Pkdrej UTSW 15 85817572 nonsense probably null
R2991:Pkdrej UTSW 15 85819936 missense probably benign 0.00
R3029:Pkdrej UTSW 15 85817004 missense probably benign 0.16
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3162:Pkdrej UTSW 15 85816617 missense probably damaging 1.00
R3747:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3748:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R3749:Pkdrej UTSW 15 85821077 missense probably damaging 0.96
R4028:Pkdrej UTSW 15 85817492 missense probably benign 0.02
R4169:Pkdrej UTSW 15 85816314 missense probably benign 0.24
R4241:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4242:Pkdrej UTSW 15 85818144 missense probably damaging 1.00
R4705:Pkdrej UTSW 15 85821167 nonsense probably null
R4939:Pkdrej UTSW 15 85820283 missense possibly damaging 0.82
R4954:Pkdrej UTSW 15 85816401 missense probably damaging 0.99
R4974:Pkdrej UTSW 15 85820409 missense probably benign 0.00
R4982:Pkdrej UTSW 15 85818996 missense probably damaging 0.99
R5105:Pkdrej UTSW 15 85816384 missense probably damaging 1.00
R5270:Pkdrej UTSW 15 85818327 missense probably damaging 1.00
R5296:Pkdrej UTSW 15 85817118 missense possibly damaging 0.67
R5631:Pkdrej UTSW 15 85820437 missense probably benign
R5909:Pkdrej UTSW 15 85818296 missense possibly damaging 0.82
R5998:Pkdrej UTSW 15 85815453 missense probably benign 0.01
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6037:Pkdrej UTSW 15 85819766 missense probably damaging 0.99
R6270:Pkdrej UTSW 15 85821105 nonsense probably null
R6500:Pkdrej UTSW 15 85819546 missense probably damaging 0.98
R6776:Pkdrej UTSW 15 85817309 nonsense probably null
R6786:Pkdrej UTSW 15 85818649 missense probably benign
R6866:Pkdrej UTSW 15 85820881 missense probably damaging 1.00
R6954:Pkdrej UTSW 15 85817853 nonsense probably null
R7086:Pkdrej UTSW 15 85820116 missense probably damaging 1.00
R7231:Pkdrej UTSW 15 85816188 missense possibly damaging 0.55
R7233:Pkdrej UTSW 15 85821148 missense probably damaging 0.96
R7289:Pkdrej UTSW 15 85821100 missense probably benign
R7549:Pkdrej UTSW 15 85819793 missense probably damaging 1.00
R7582:Pkdrej UTSW 15 85818921 missense possibly damaging 0.92
R7677:Pkdrej UTSW 15 85815587 missense probably benign 0.01
R7791:Pkdrej UTSW 15 85815931 missense possibly damaging 0.87
R7873:Pkdrej UTSW 15 85816523 missense probably benign 0.29
R7956:Pkdrej UTSW 15 85816523 missense probably benign 0.29
Z1177:Pkdrej UTSW 15 85816537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGATGTAGCCCTCGTCCAC -3'
(R):5'- AGCCATGGGTTTACTTATAAGCC -3'

Sequencing Primer
(F):5'- GATGTAGCCCTCGTCCACAACATAG -3'
(R):5'- TTACTTATAAGCCTCCGGGGAAAAG -3'
Posted On2017-10-10