Incidental Mutation 'R6126:Mfsd8'
ID487379
Institutional Source Beutler Lab
Gene Symbol Mfsd8
Ensembl Gene ENSMUSG00000025759
Gene Namemajor facilitator superfamily domain containing 8
Synonyms2810423E13Rik, Cln7
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location40818103-40846886 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 40832011 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026859 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026859] [ENSMUST00000204054] [ENSMUST00000204907]
Predicted Effect probably null
Transcript: ENSMUST00000026859
SMART Domains Protein: ENSMUSP00000026859
Gene: ENSMUSG00000025759

DomainStartEndE-ValueType
Pfam:Sugar_tr 31 235 3.6e-13 PFAM
Pfam:MFS_1 43 387 4.2e-31 PFAM
transmembrane domain 417 439 N/A INTRINSIC
transmembrane domain 452 474 N/A INTRINSIC
transmembrane domain 484 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204054
Predicted Effect probably benign
Transcript: ENSMUST00000204399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204454
Predicted Effect probably benign
Transcript: ENSMUST00000204907
SMART Domains Protein: ENSMUSP00000144842
Gene: ENSMUSG00000025759

DomainStartEndE-ValueType
Pfam:MFS_1 1 187 2e-21 PFAM
Pfam:Sugar_tr 7 186 3.8e-12 PFAM
Meta Mutation Damage Score 0.9484 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous integral membrane protein that contains a transporter domain and a major facilitator superfamily (MFS) domain. Other members of the major facilitator superfamily transport small solutes through chemiosmotic ion gradients. The substrate transported by this protein is unknown. The protein likely localizes to lysosomal membranes. Mutations in this gene are correlated with a variant form of late infantile-onset neuronal ceroid lipofuscinoses (vLINCL). [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit accumulation of autofluorescent material in the brain and peripheral tissues, retinal photoreceptor degeneration, presence of dense lamellar bodies in neurons, and a late-onset reactive gliosis and subtle astrogliosis in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Mfsd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1300:Mfsd8 UTSW 3 40823898 missense probably benign 0.32
R4660:Mfsd8 UTSW 3 40821937 missense probably benign 0.06
R5670:Mfsd8 UTSW 3 40822049 missense probably benign
R6092:Mfsd8 UTSW 3 40819596 missense possibly damaging 0.71
R6445:Mfsd8 UTSW 3 40837118 missense probably damaging 1.00
R7571:Mfsd8 UTSW 3 40830662 missense probably damaging 0.96
R8015:Mfsd8 UTSW 3 40846835 unclassified probably benign
R8169:Mfsd8 UTSW 3 40837115 missense probably benign 0.00
R8242:Mfsd8 UTSW 3 40835193 missense probably damaging 1.00
R8243:Mfsd8 UTSW 3 40835193 missense probably damaging 1.00
R8285:Mfsd8 UTSW 3 40835193 missense probably damaging 1.00
R8335:Mfsd8 UTSW 3 40835193 missense probably damaging 1.00
R8337:Mfsd8 UTSW 3 40835193 missense probably damaging 1.00
Z1177:Mfsd8 UTSW 3 40846861 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGAACCCATCTATAGACAGCAG -3'
(R):5'- GTGCCCATATCAAAACTGACGTG -3'

Sequencing Primer
(F):5'- CTATAATCTCAGCTGCCTGGAGG -3'
(R):5'- GCCCATATCAAAACTGACGTGTACAC -3'
Posted On2017-10-10