Incidental Mutation 'R6126:4933434E20Rik'
ID 487380
Institutional Source Beutler Lab
Gene Symbol 4933434E20Rik
Ensembl Gene ENSMUSG00000027942
Gene Name RIKEN cDNA 4933434E20 gene
Synonyms
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 90051636-90068347 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 90056574 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 111 (R111H)
Ref Sequence ENSEMBL: ENSMUSP00000124822 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029552] [ENSMUST00000029553] [ENSMUST00000064639] [ENSMUST00000068798] [ENSMUST00000090908] [ENSMUST00000159064] [ENSMUST00000160640] [ENSMUST00000161918] [ENSMUST00000162114] [ENSMUST00000195995] [ENSMUST00000197903] [ENSMUST00000196633] [ENSMUST00000198322] [ENSMUST00000199929] [ENSMUST00000196843] [ENSMUST00000199834]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000029552
AA Change: R111H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029552
Gene: ENSMUSG00000027942
AA Change: R111H

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.3e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029553
SMART Domains Protein: ENSMUSP00000029553
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000064639
SMART Domains Protein: ENSMUSP00000066138
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 394 403 N/A INTRINSIC
low complexity region 405 414 N/A INTRINSIC
low complexity region 464 489 N/A INTRINSIC
Pfam:DUF3697 520 551 4.1e-18 PFAM
low complexity region 559 594 N/A INTRINSIC
low complexity region 670 680 N/A INTRINSIC
low complexity region 719 750 N/A INTRINSIC
low complexity region 753 809 N/A INTRINSIC
low complexity region 813 827 N/A INTRINSIC
low complexity region 898 921 N/A INTRINSIC
low complexity region 1043 1056 N/A INTRINSIC
low complexity region 1077 1092 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068798
SMART Domains Protein: ENSMUSP00000066840
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 171 2.6e-70 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090908
SMART Domains Protein: ENSMUSP00000088424
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000159064
AA Change: R111H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124554
Gene: ENSMUSG00000027942
AA Change: R111H

DomainStartEndE-ValueType
Pfam:NICE-3 6 188 4.2e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159202
SMART Domains Protein: ENSMUSP00000123777
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 61 2.3e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160263
Predicted Effect probably damaging
Transcript: ENSMUST00000160640
AA Change: R111H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124028
Gene: ENSMUSG00000027942
AA Change: R111H

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 3.2e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161874
Predicted Effect probably benign
Transcript: ENSMUST00000161918
SMART Domains Protein: ENSMUSP00000123740
Gene: ENSMUSG00000027942

DomainStartEndE-ValueType
Pfam:NICE-3 1 64 2.2e-34 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000162114
AA Change: R111H

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000124822
Gene: ENSMUSG00000027942
AA Change: R111H

DomainStartEndE-ValueType
Pfam:NICE-3 1 189 1.4e-89 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162595
Predicted Effect probably benign
Transcript: ENSMUST00000195995
SMART Domains Protein: ENSMUSP00000143638
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 526 557 3.7e-18 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196568
Predicted Effect probably benign
Transcript: ENSMUST00000197903
SMART Domains Protein: ENSMUSP00000143519
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 81 7e-32 PDB
Blast:UBA 50 81 7e-16 BLAST
SCOP:d1efub3 51 81 3e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196633
SMART Domains Protein: ENSMUSP00000143423
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 6.3e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000198322
SMART Domains Protein: ENSMUSP00000142524
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 369 378 N/A INTRINSIC
low complexity region 380 389 N/A INTRINSIC
low complexity region 439 464 N/A INTRINSIC
Pfam:DUF3697 494 526 4.1e-22 PFAM
low complexity region 534 569 N/A INTRINSIC
low complexity region 645 655 N/A INTRINSIC
low complexity region 694 725 N/A INTRINSIC
low complexity region 728 784 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 873 896 N/A INTRINSIC
low complexity region 1017 1030 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199929
SMART Domains Protein: ENSMUSP00000142488
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
PDB:1WJ7|A 31 57 2e-12 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000196843
SMART Domains Protein: ENSMUSP00000143459
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 152 N/A INTRINSIC
low complexity region 162 190 N/A INTRINSIC
low complexity region 213 226 N/A INTRINSIC
low complexity region 389 398 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 459 484 N/A INTRINSIC
Pfam:DUF3697 514 546 4e-22 PFAM
low complexity region 554 589 N/A INTRINSIC
low complexity region 665 675 N/A INTRINSIC
low complexity region 714 745 N/A INTRINSIC
low complexity region 748 804 N/A INTRINSIC
low complexity region 808 822 N/A INTRINSIC
low complexity region 893 916 N/A INTRINSIC
low complexity region 1038 1051 N/A INTRINSIC
low complexity region 1072 1087 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199834
SMART Domains Protein: ENSMUSP00000143254
Gene: ENSMUSG00000042520

DomainStartEndE-ValueType
low complexity region 16 30 N/A INTRINSIC
UBA 50 88 1.31e-9 SMART
low complexity region 124 148 N/A INTRINSIC
low complexity region 173 201 N/A INTRINSIC
low complexity region 224 237 N/A INTRINSIC
low complexity region 400 409 N/A INTRINSIC
low complexity region 411 420 N/A INTRINSIC
low complexity region 470 495 N/A INTRINSIC
Pfam:DUF3697 525 557 3.6e-22 PFAM
low complexity region 565 600 N/A INTRINSIC
low complexity region 676 686 N/A INTRINSIC
low complexity region 725 756 N/A INTRINSIC
low complexity region 759 815 N/A INTRINSIC
low complexity region 819 833 N/A INTRINSIC
low complexity region 904 927 N/A INTRINSIC
Meta Mutation Damage Score 0.1896 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in 4933434E20Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:4933434E20Rik APN 3 90053093 missense possibly damaging 0.65
IGL01621:4933434E20Rik APN 3 90064502 missense possibly damaging 0.82
IGL01984:4933434E20Rik APN 3 90063230 missense probably benign 0.00
IGL02005:4933434E20Rik APN 3 90058620 missense probably damaging 1.00
R0446:4933434E20Rik UTSW 3 90064459 missense probably benign 0.00
R1717:4933434E20Rik UTSW 3 90056237 missense probably benign 0.23
R1816:4933434E20Rik UTSW 3 90053091 missense possibly damaging 0.89
R2170:4933434E20Rik UTSW 3 90056304 missense probably benign 0.07
R2299:4933434E20Rik UTSW 3 90064538 missense possibly damaging 0.88
R2981:4933434E20Rik UTSW 3 90058631 missense probably benign 0.00
R3879:4933434E20Rik UTSW 3 90063254 unclassified probably benign
R4065:4933434E20Rik UTSW 3 90058766 nonsense probably null
R4724:4933434E20Rik UTSW 3 90053541 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053542 missense probably damaging 1.00
R4724:4933434E20Rik UTSW 3 90053583 missense probably damaging 0.99
R4835:4933434E20Rik UTSW 3 90063209 missense probably benign 0.22
R5076:4933434E20Rik UTSW 3 90056252 missense probably benign 0.01
R6337:4933434E20Rik UTSW 3 90061733 missense probably benign 0.03
R6562:4933434E20Rik UTSW 3 90063236 missense probably benign 0.38
R7312:4933434E20Rik UTSW 3 90061714 missense probably benign 0.07
R7316:4933434E20Rik UTSW 3 90061713 missense probably benign
R7473:4933434E20Rik UTSW 3 90058653 critical splice donor site probably null
R7990:4933434E20Rik UTSW 3 90063242 missense probably damaging 0.98
R8125:4933434E20Rik UTSW 3 90065511 missense possibly damaging 0.92
R9268:4933434E20Rik UTSW 3 90061723 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- TGAGGAGTCCCACAGCTTTAG -3'
(R):5'- ACAGAGCAAACTGAGGTGATTT -3'

Sequencing Primer
(F):5'- GAGGAGTCCCACAGCTTTAGAATTC -3'
(R):5'- GATGTCCCAGAACTGCCTTAGTAG -3'
Posted On 2017-10-10