Incidental Mutation 'R6126:Zfp462'
ID487384
Institutional Source Beutler Lab
Gene Symbol Zfp462
Ensembl Gene ENSMUSG00000060206
Gene Namezinc finger protein 462
SynonymsZfpip, 9430078C22Rik, Gt4-2
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.570) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location54945048-55083563 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55023573 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 2121 (A2121T)
Ref Sequence ENSEMBL: ENSMUSP00000095677 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030131] [ENSMUST00000079605] [ENSMUST00000098070]
Predicted Effect probably benign
Transcript: ENSMUST00000030131
AA Change: A1033T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030131
Gene: ENSMUSG00000060206
AA Change: A1033T

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 892 914 3.11e-2 SMART
ZnF_C2H2 926 948 4.11e-2 SMART
ZnF_C2H2 955 978 4.98e-1 SMART
ZnF_C2H2 984 1007 5.5e-3 SMART
ZnF_C2H2 1092 1115 7.05e-1 SMART
ZnF_C2H2 1121 1144 5.48e0 SMART
ZnF_C2H2 1155 1177 6.13e-1 SMART
ZnF_C2H2 1201 1223 1.26e-2 SMART
ZnF_C2H2 1229 1252 2.02e-1 SMART
low complexity region 1273 1296 N/A INTRINSIC
ZnF_C2H2 1315 1337 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000079605
AA Change: A1034T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000078555
Gene: ENSMUSG00000060206
AA Change: A1034T

DomainStartEndE-ValueType
ZnF_C2H2 35 58 4.81e0 SMART
ZnF_C2H2 106 129 6.67e-2 SMART
ZnF_C2H2 153 176 3.47e0 SMART
ZnF_C2H2 210 233 7.29e0 SMART
ZnF_C2H2 311 334 2.17e-1 SMART
ZnF_C2H2 356 379 6.57e0 SMART
ZnF_C2H2 418 441 5.34e-1 SMART
low complexity region 450 463 N/A INTRINSIC
ZnF_C2H2 501 524 8.22e-2 SMART
ZnF_C2H2 538 561 5.34e0 SMART
ZnF_C2H2 608 631 6.4e0 SMART
low complexity region 655 676 N/A INTRINSIC
ZnF_C2H2 687 711 3.05e1 SMART
ZnF_C2H2 733 755 1.08e-1 SMART
low complexity region 757 771 N/A INTRINSIC
ZnF_C2H2 809 831 1.51e0 SMART
ZnF_C2H2 893 915 3.11e-2 SMART
ZnF_C2H2 927 949 4.11e-2 SMART
ZnF_C2H2 956 979 4.98e-1 SMART
ZnF_C2H2 985 1008 5.5e-3 SMART
ZnF_C2H2 1093 1116 7.05e-1 SMART
ZnF_C2H2 1122 1145 5.48e0 SMART
ZnF_C2H2 1156 1178 6.13e-1 SMART
ZnF_C2H2 1202 1224 1.26e-2 SMART
ZnF_C2H2 1230 1253 2.02e-1 SMART
low complexity region 1274 1297 N/A INTRINSIC
ZnF_C2H2 1316 1338 2.2e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000098070
AA Change: A2121T

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000095677
Gene: ENSMUSG00000060206
AA Change: A2121T

DomainStartEndE-ValueType
ZnF_C2H2 4 27 5.81e-2 SMART
low complexity region 81 94 N/A INTRINSIC
ZnF_C2H2 108 131 1.79e-2 SMART
ZnF_C2H2 162 185 4.65e-1 SMART
low complexity region 194 215 N/A INTRINSIC
ZnF_C2H2 243 266 4.98e-1 SMART
low complexity region 332 343 N/A INTRINSIC
ZnF_C2H2 440 463 1.01e-1 SMART
ZnF_C2H2 471 493 2.86e-1 SMART
low complexity region 503 515 N/A INTRINSIC
low complexity region 536 592 N/A INTRINSIC
ZnF_C2H2 593 616 2.53e-2 SMART
low complexity region 707 736 N/A INTRINSIC
ZnF_C2H2 835 858 5.62e0 SMART
ZnF_C2H2 878 900 2.14e0 SMART
ZnF_C2H2 917 940 6.67e-2 SMART
ZnF_C2H2 1023 1046 5.72e-1 SMART
low complexity region 1092 1100 N/A INTRINSIC
ZnF_C2H2 1107 1130 4.23e0 SMART
ZnF_C2H2 1183 1206 4.81e0 SMART
ZnF_C2H2 1254 1277 6.67e-2 SMART
ZnF_C2H2 1301 1324 3.47e0 SMART
ZnF_C2H2 1358 1381 7.29e0 SMART
ZnF_C2H2 1459 1482 2.17e-1 SMART
ZnF_C2H2 1504 1527 6.57e0 SMART
ZnF_C2H2 1566 1589 5.34e-1 SMART
low complexity region 1598 1611 N/A INTRINSIC
ZnF_C2H2 1649 1672 8.22e-2 SMART
ZnF_C2H2 1686 1709 5.34e0 SMART
ZnF_C2H2 1756 1779 6.4e0 SMART
low complexity region 1803 1824 N/A INTRINSIC
ZnF_C2H2 1835 1859 3.05e1 SMART
ZnF_C2H2 1881 1903 1.08e-1 SMART
low complexity region 1905 1919 N/A INTRINSIC
ZnF_C2H2 1957 1979 1.51e0 SMART
ZnF_C2H2 2014 2036 4.11e-2 SMART
ZnF_C2H2 2043 2066 4.98e-1 SMART
ZnF_C2H2 2072 2095 5.5e-3 SMART
ZnF_C2H2 2180 2203 7.05e-1 SMART
ZnF_C2H2 2209 2232 5.48e0 SMART
ZnF_C2H2 2243 2265 6.13e-1 SMART
ZnF_C2H2 2289 2311 1.26e-2 SMART
ZnF_C2H2 2317 2340 2.02e-1 SMART
low complexity region 2361 2384 N/A INTRINSIC
ZnF_C2H2 2403 2425 2.2e-2 SMART
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to C2H2-type zinc finger family of proteins. It contains multiple C2H2-type zinc fingers and may be involved in transcriptional regulation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Zfp462
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00162:Zfp462 APN 4 55011483 unclassified probably null
IGL00421:Zfp462 APN 4 55023576 missense probably benign 0.00
IGL00899:Zfp462 APN 4 55007732 missense probably damaging 1.00
IGL01549:Zfp462 APN 4 55013181 missense probably damaging 1.00
IGL01627:Zfp462 APN 4 55008912 missense possibly damaging 0.93
IGL01715:Zfp462 APN 4 55008586 missense probably benign 0.20
IGL01862:Zfp462 APN 4 55023441 missense probably damaging 1.00
IGL01878:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL01913:Zfp462 APN 4 55012138 missense probably benign 0.04
IGL02029:Zfp462 APN 4 55079395 splice site probably benign
IGL02338:Zfp462 APN 4 55010292 missense possibly damaging 0.88
IGL02552:Zfp462 APN 4 55010613 missense probably damaging 1.00
IGL02623:Zfp462 APN 4 55012986 missense probably damaging 1.00
IGL02750:Zfp462 APN 4 55060236 missense probably null 1.00
IGL02815:Zfp462 APN 4 55051303 missense probably damaging 1.00
IGL03204:Zfp462 APN 4 55080785 missense possibly damaging 0.80
FR4304:Zfp462 UTSW 4 55009757 unclassified probably benign
FR4304:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009758 unclassified probably benign
FR4737:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009760 unclassified probably benign
FR4976:Zfp462 UTSW 4 55009761 unclassified probably benign
P0035:Zfp462 UTSW 4 55009086 missense probably benign
R0052:Zfp462 UTSW 4 55011762 missense probably benign 0.03
R0143:Zfp462 UTSW 4 55023402 splice site probably benign
R0145:Zfp462 UTSW 4 55010529 missense probably damaging 1.00
R0315:Zfp462 UTSW 4 55079314 missense probably damaging 0.99
R0349:Zfp462 UTSW 4 55008768 missense probably benign
R0359:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0413:Zfp462 UTSW 4 55010534 missense probably damaging 0.99
R0554:Zfp462 UTSW 4 55013689 missense probably damaging 1.00
R0616:Zfp462 UTSW 4 55011951 missense probably damaging 1.00
R0631:Zfp462 UTSW 4 55007563 start codon destroyed possibly damaging 0.60
R1086:Zfp462 UTSW 4 55013000 missense probably damaging 1.00
R1499:Zfp462 UTSW 4 55060046 missense probably damaging 1.00
R1509:Zfp462 UTSW 4 55007667 missense probably damaging 1.00
R1526:Zfp462 UTSW 4 55009002 missense probably benign
R1541:Zfp462 UTSW 4 55008928 missense possibly damaging 0.53
R1691:Zfp462 UTSW 4 55013489 missense possibly damaging 0.70
R1843:Zfp462 UTSW 4 55010010 missense possibly damaging 0.88
R2086:Zfp462 UTSW 4 55010830 missense probably damaging 1.00
R2109:Zfp462 UTSW 4 55008496 missense probably benign 0.00
R2148:Zfp462 UTSW 4 55013670 missense probably benign 0.01
R2179:Zfp462 UTSW 4 55009524 missense possibly damaging 0.73
R2325:Zfp462 UTSW 4 55013712 missense probably benign
R2352:Zfp462 UTSW 4 55008313 missense probably null
R2566:Zfp462 UTSW 4 55008522 missense probably benign 0.00
R3879:Zfp462 UTSW 4 55060095 missense probably damaging 1.00
R3969:Zfp462 UTSW 4 55012402 missense probably damaging 1.00
R4273:Zfp462 UTSW 4 55008411 missense probably benign 0.00
R4413:Zfp462 UTSW 4 55012672 missense probably damaging 0.99
R4510:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4511:Zfp462 UTSW 4 55008934 missense possibly damaging 0.86
R4609:Zfp462 UTSW 4 55011889 missense probably damaging 1.00
R4632:Zfp462 UTSW 4 55012981 missense probably damaging 1.00
R4649:Zfp462 UTSW 4 55009349 missense probably benign
R4682:Zfp462 UTSW 4 55011376 missense probably damaging 1.00
R4696:Zfp462 UTSW 4 55008612 missense probably benign
R4744:Zfp462 UTSW 4 55011598 missense probably damaging 1.00
R4747:Zfp462 UTSW 4 55013476 missense probably benign 0.00
R4819:Zfp462 UTSW 4 55060044 missense probably damaging 1.00
R4827:Zfp462 UTSW 4 55012213 missense probably damaging 1.00
R4854:Zfp462 UTSW 4 55010668 missense probably damaging 1.00
R4879:Zfp462 UTSW 4 55009444 missense probably benign 0.02
R4891:Zfp462 UTSW 4 55060055 missense probably damaging 1.00
R4993:Zfp462 UTSW 4 55051204 missense possibly damaging 0.62
R5118:Zfp462 UTSW 4 55010667 missense probably damaging 1.00
R5171:Zfp462 UTSW 4 55016986 splice site probably null
R5173:Zfp462 UTSW 4 55011115 missense probably damaging 0.99
R5221:Zfp462 UTSW 4 55016887 missense possibly damaging 0.86
R5268:Zfp462 UTSW 4 55012299 missense probably benign
R5314:Zfp462 UTSW 4 55013178 missense probably damaging 1.00
R5429:Zfp462 UTSW 4 55060077 missense probably damaging 1.00
R5518:Zfp462 UTSW 4 55009818 missense probably damaging 0.99
R5525:Zfp462 UTSW 4 55050281 missense possibly damaging 0.73
R5620:Zfp462 UTSW 4 55013464 missense probably benign 0.01
R5775:Zfp462 UTSW 4 55010590 missense probably damaging 0.99
R6280:Zfp462 UTSW 4 55010253 missense probably benign 0.00
R6325:Zfp462 UTSW 4 55080680 missense probably benign 0.04
R6542:Zfp462 UTSW 4 55023433 missense probably damaging 1.00
R6612:Zfp462 UTSW 4 55012324 unclassified probably null
R6663:Zfp462 UTSW 4 55008933 missense possibly damaging 0.53
R6872:Zfp462 UTSW 4 55012326 missense probably benign 0.01
R6889:Zfp462 UTSW 4 55007671 missense probably damaging 1.00
R6896:Zfp462 UTSW 4 55009544 missense possibly damaging 0.72
R6913:Zfp462 UTSW 4 55007775 missense probably benign 0.25
R6988:Zfp462 UTSW 4 55080716 missense probably benign 0.00
R7131:Zfp462 UTSW 4 55009380 missense probably benign
R7151:Zfp462 UTSW 4 55051271 missense probably damaging 0.99
R7684:Zfp462 UTSW 4 55008908 missense probably benign
R7741:Zfp462 UTSW 4 55008637 missense probably benign 0.00
R7750:Zfp462 UTSW 4 55016958 missense probably benign 0.06
R7812:Zfp462 UTSW 4 55008509 missense probably benign 0.00
R7863:Zfp462 UTSW 4 55007747 missense probably benign
R7898:Zfp462 UTSW 4 55012995 missense probably damaging 0.98
R7993:Zfp462 UTSW 4 55011907 missense probably damaging 1.00
R7995:Zfp462 UTSW 4 55011907 missense probably damaging 1.00
R8023:Zfp462 UTSW 4 55073106 critical splice donor site probably null
R8394:Zfp462 UTSW 4 55011862 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTTCTAGGTGAACATGCC -3'
(R):5'- CATCCTGCCCAGCATGATAC -3'

Sequencing Primer
(F):5'- GGTGAACATGCCTACAAGTGTTC -3'
(R):5'- TGCCCAGCATGATACTTTAACGG -3'
Posted On2017-10-10