Incidental Mutation 'R6126:Foxd2'
ID 487385
Institutional Source Beutler Lab
Gene Symbol Foxd2
Ensembl Gene ENSMUSG00000055210
Gene Name forkhead box D2
Synonyms Mf2
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.404) question?
Stock # R6126 (G1)
Quality Score 89.0077
Status Not validated
Chromosome 4
Chromosomal Location 114906282-114908873 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 114908505 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glycine to Valine at position 106 (G106V)
Ref Sequence ENSEMBL: ENSMUSP00000066868 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068654]
AlphaFold O35392
Predicted Effect unknown
Transcript: ENSMUST00000068654
AA Change: G106V
SMART Domains Protein: ENSMUSP00000066868
Gene: ENSMUSG00000055210
AA Change: G106V

DomainStartEndE-ValueType
low complexity region 5 26 N/A INTRINSIC
low complexity region 31 37 N/A INTRINSIC
low complexity region 57 73 N/A INTRINSIC
low complexity region 82 126 N/A INTRINSIC
FH 127 217 1.01e-60 SMART
low complexity region 229 259 N/A INTRINSIC
low complexity region 263 304 N/A INTRINSIC
low complexity region 310 351 N/A INTRINSIC
low complexity region 365 384 N/A INTRINSIC
low complexity region 392 404 N/A INTRINSIC
low complexity region 416 444 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123272
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144002
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the forkhead family of transcription factors which is characterized by a distinct forkhead domain. The specific function of this gene has not yet been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit renal abnormalities including kidney hypoplasia and hydroureter. Penetrance is reduced, and dependent upon the genetic background. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Foxd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1168:Foxd2 UTSW 4 114907678 missense possibly damaging 0.85
R1183:Foxd2 UTSW 4 114907465 missense possibly damaging 0.68
R1479:Foxd2 UTSW 4 114907918 missense unknown
R3885:Foxd2 UTSW 4 114908286 missense unknown
R3886:Foxd2 UTSW 4 114908286 missense unknown
R3887:Foxd2 UTSW 4 114908286 missense unknown
R3888:Foxd2 UTSW 4 114908286 missense unknown
R3889:Foxd2 UTSW 4 114908286 missense unknown
R4874:Foxd2 UTSW 4 114907571 missense possibly damaging 0.53
R5646:Foxd2 UTSW 4 114908635 missense unknown
R7235:Foxd2 UTSW 4 114908271 missense unknown
R7749:Foxd2 UTSW 4 114907812 missense unknown
R9697:Foxd2 UTSW 4 114908487 missense unknown
R9715:Foxd2 UTSW 4 114907998 missense unknown
R9786:Foxd2 UTSW 4 114907653 missense possibly damaging 0.86
Z1177:Foxd2 UTSW 4 114907887 missense unknown
Predicted Primers PCR Primer
(F):5'- GGGGATCTTAACGAAGCAGTC -3'
(R):5'- TGCTGCGAGATCATGTCCTC -3'

Sequencing Primer
(F):5'- GGAACTTCTCCCGGTAGTAGG -3'
(R):5'- AGATCATGTCCTCCGAGAGCTC -3'
Posted On 2017-10-10