Incidental Mutation 'R6126:Rab35'
ID 487388
Institutional Source Beutler Lab
Gene Symbol Rab35
Ensembl Gene ENSMUSG00000029518
Gene Name RAB35, member RAS oncogene family
Synonyms H-ray, 9530019H02Rik, RAB1C
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 115769953-115785217 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 115783767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 185 (N185D)
Ref Sequence ENSEMBL: ENSMUSP00000031492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031492] [ENSMUST00000055408] [ENSMUST00000118576] [ENSMUST00000121746] [ENSMUST00000138885] [ENSMUST00000141976]
AlphaFold Q6PHN9
Predicted Effect probably benign
Transcript: ENSMUST00000031492
AA Change: N185D

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000031492
Gene: ENSMUSG00000029518
AA Change: N185D

DomainStartEndE-ValueType
RAB 9 171 5.07e-89 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055408
SMART Domains Protein: ENSMUSP00000053547
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
low complexity region 47 68 N/A INTRINSIC
Pfam:HAP1_N 97 162 2e-11 PFAM
low complexity region 305 316 N/A INTRINSIC
low complexity region 336 374 N/A INTRINSIC
low complexity region 389 410 N/A INTRINSIC
coiled coil region 467 529 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118576
SMART Domains Protein: ENSMUSP00000112842
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121746
SMART Domains Protein: ENSMUSP00000112949
Gene: ENSMUSG00000041609

DomainStartEndE-ValueType
coiled coil region 5 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000138885
SMART Domains Protein: ENSMUSP00000138402
Gene: ENSMUSG00000029518

DomainStartEndE-ValueType
Pfam:Ras 10 42 1e-8 PFAM
Pfam:Miro 10 46 7.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141976
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201869
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183566
Meta Mutation Damage Score 0.0677 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 89,963,881 (GRCm39) R111H probably damaging Het
Alk G A 17: 72,182,037 (GRCm39) L1329F possibly damaging Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
Atp8a2 C T 14: 60,281,775 (GRCm39) M126I probably benign Het
Cactin G A 10: 81,160,143 (GRCm39) R412H possibly damaging Het
Chd7 T C 4: 8,826,482 (GRCm39) S949P probably damaging Het
Clec11a C T 7: 43,954,345 (GRCm39) A203T probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dst T A 1: 34,267,264 (GRCm39) I5080K probably damaging Het
Ecd T C 14: 20,388,493 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fan1 T A 7: 64,014,318 (GRCm39) K638* probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fig4 A G 10: 41,141,443 (GRCm39) I272T probably damaging Het
Foxd2 C A 4: 114,765,702 (GRCm39) G106V unknown Het
Ggcx A T 6: 72,394,966 (GRCm39) M115L possibly damaging Het
Gm21976 G A 13: 98,423,821 (GRCm39) R72H unknown Het
Hsf2 T C 10: 57,372,013 (GRCm39) V38A probably damaging Het
Ifi208 A G 1: 173,505,274 (GRCm39) Y8C possibly damaging Het
Il31ra A C 13: 112,666,908 (GRCm39) L390R probably damaging Het
Kif1a A T 1: 92,947,621 (GRCm39) Y1614N probably damaging Het
Mef2b C A 8: 70,619,526 (GRCm39) T267K probably benign Het
Mfsd8 A G 3: 40,786,446 (GRCm39) probably null Het
Mnx1 G T 5: 29,683,110 (GRCm39) A55E possibly damaging Het
Muc5ac A T 7: 141,354,969 (GRCm39) I949F possibly damaging Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Ntpcr G A 8: 126,462,626 (GRCm39) probably null Het
Or12j3 T G 7: 139,953,166 (GRCm39) Y119S probably damaging Het
Otx1 T C 11: 21,946,457 (GRCm39) probably benign Het
Panx1 T A 9: 14,919,086 (GRCm39) I258F probably benign Het
Pask T C 1: 93,242,081 (GRCm39) Y1212C probably damaging Het
Pdgfra A G 5: 75,331,190 (GRCm39) K265R probably benign Het
Phf20l1 A G 15: 66,508,673 (GRCm39) H844R probably benign Het
Ppp6r1 T C 7: 4,646,376 (GRCm39) T136A possibly damaging Het
Rdh1 A T 10: 127,599,083 (GRCm39) D188V probably damaging Het
Rimbp3 A T 16: 17,030,140 (GRCm39) D1188V probably benign Het
Robo2 C T 16: 73,717,570 (GRCm39) G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr1 A C 7: 28,775,664 (GRCm39) D2282E probably null Het
Ryr3 A G 2: 112,588,015 (GRCm39) L2642P probably damaging Het
Sez6 A T 11: 77,864,630 (GRCm39) Y530F probably damaging Het
Slc12a2 A G 18: 58,077,116 (GRCm39) Y1205C possibly damaging Het
Slc4a5 A T 6: 83,203,247 (GRCm39) H49L probably benign Het
Smchd1 A T 17: 71,677,280 (GRCm39) V1503D probably damaging Het
Spata31e3 G T 13: 50,400,326 (GRCm39) Q667K probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tex15 A G 8: 34,063,591 (GRCm39) N1007S probably benign Het
Tpk1 A T 6: 43,400,594 (GRCm39) C143S probably damaging Het
Wdr20 A T 12: 110,760,536 (GRCm39) H474L probably benign Het
Wnk4 A G 11: 101,167,174 (GRCm39) probably benign Het
Zfp292 T C 4: 34,808,497 (GRCm39) T1516A probably benign Het
Zfp462 G A 4: 55,023,573 (GRCm39) A2121T probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Rab35
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0502:Rab35 UTSW 5 115,783,723 (GRCm39) missense probably benign 0.02
R1858:Rab35 UTSW 5 115,778,147 (GRCm39) missense probably damaging 0.98
R1879:Rab35 UTSW 5 115,778,219 (GRCm39) missense probably damaging 1.00
R4480:Rab35 UTSW 5 115,775,823 (GRCm39) nonsense probably null
R4824:Rab35 UTSW 5 115,781,454 (GRCm39) missense possibly damaging 0.95
R4937:Rab35 UTSW 5 115,778,147 (GRCm39) missense probably damaging 0.96
R6062:Rab35 UTSW 5 115,778,147 (GRCm39) missense probably damaging 0.98
R8515:Rab35 UTSW 5 115,781,467 (GRCm39) missense probably damaging 0.96
R8554:Rab35 UTSW 5 115,783,690 (GRCm39) critical splice acceptor site probably null
R9256:Rab35 UTSW 5 115,778,246 (GRCm39) missense probably damaging 1.00
R9760:Rab35 UTSW 5 115,778,224 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGAGGACATACATGCAGTTCACAG -3'
(R):5'- GTCCAACACCTTCTTGGCAC -3'

Sequencing Primer
(F):5'- CATACATGCAGTTCACAGAGAAATAG -3'
(R):5'- ATGGCGCCTCCCCATAC -3'
Posted On 2017-10-10