Mutagenetix > Incidental Mutation

Incidental Mutation 'R0523:Vps13b'

48739

Institutional Source

Beutler Lab

Gene Symbol

Vps13b

Ensembl Gene

ENSMUSG00000037646

Gene Name

vacuolar protein sorting 13B

Synonyms

2310042E16Rik, 1810042B05Rik, Coh1, C330002D13Rik

MMRRC Submission

038716-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

35371160-35931229 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 35472050 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 833 (V833A)

Ref Sequence

ENSEMBL: ENSMUSP00000045490 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000048646]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000048646
AA Change: V833A

PolyPhen 2 Score 0.204 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000045490
Gene: ENSMUSG00000037646
AA Change: V833A

Domain	Start	End	E-Value	Type
Pfam:Chorein_N	2	120	1e-29	PFAM
low complexity region	128	137	N/A	INTRINSIC
low complexity region	143	160	N/A	INTRINSIC
low complexity region	975	984	N/A	INTRINSIC
low complexity region	1007	1018	N/A	INTRINSIC
low complexity region	1876	1883	N/A	INTRINSIC
low complexity region	2042	2054	N/A	INTRINSIC
low complexity region	2414	2423	N/A	INTRINSIC
Pfam:SHR-BD	2601	2700	8.4e-10	PFAM
low complexity region	2954	2964	N/A	INTRINSIC
Pfam:VPS13_C	3539	3706	2.6e-30	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226579

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a potential transmembrane protein that may function in vesicle-mediated transport and sorting of proteins within the cell. This protein may play a role in the development and the function of the eye, hematological system, and central nervous system. Mutations in this gene have been associated with Cohen syndrome. Multiple splice variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,644,629	M1K	probably null	Het
2410089E03Rik	T	A	15: 8,194,386	Y878N	probably damaging	Het
A2ml1	T	C	6: 128,558,326	D807G	possibly damaging	Het
Actl9	T	A	17: 33,433,349	W128R	probably damaging	Het
Aggf1	T	C	13: 95,356,416	I562V	probably damaging	Het
Ano3	T	A	2: 110,884,855	E79D	probably benign	Het
Apobec1	T	A	6: 122,581,545	I84F	probably damaging	Het
Atp6v1b2	T	C	8: 69,109,985	F458L	possibly damaging	Het
BC051142	G	T	17: 34,445,499		probably null	Het
Bco2	A	T	9: 50,534,626	V490E	probably damaging	Het
Catsperg1	G	A	7: 29,185,190		probably benign	Het
Cdc37	T	C	9: 21,142,996	K111R	probably damaging	Het
Cfap54	T	C	10: 92,908,883		probably benign	Het
Cpox	T	A	16: 58,675,245	C308*	probably null	Het
Ctnna3	T	G	10: 64,675,909	M626R	probably damaging	Het
Cyp2c68	T	C	19: 39,739,429	E93G	probably benign	Het
Cyp2s1	G	A	7: 25,806,050	R330W	probably damaging	Het
Diaph1	C	T	18: 37,856,500	V860I	possibly damaging	Het
Dicer1	A	G	12: 104,702,491	S1311P	probably damaging	Het
Dpyd	G	A	3: 118,899,203	R332K	probably benign	Het
E130308A19Rik	G	A	4: 59,719,716	R416H	probably damaging	Het
Eef1d	T	C	15: 75,903,156	D218G	probably benign	Het
Eif2ak1	T	C	5: 143,882,166	V215A	probably damaging	Het
Eif2ak4	T	C	2: 118,442,096		probably null	Het
Fam71e2	A	G	7: 4,759,393	S246P	possibly damaging	Het
Fcrl5	T	C	3: 87,457,792	S583P	possibly damaging	Het
Grid2ip	C	A	5: 143,373,043	Q29K	possibly damaging	Het
Htr1f	A	T	16: 64,925,899	N343K	probably damaging	Het
Hvcn1	T	C	5: 122,216,365		probably null	Het
Igf2r	T	C	17: 12,692,064	I1956V	probably benign	Het
Impdh2	A	T	9: 108,561,819		probably null	Het
Impdh2	C	T	9: 108,561,820	T96I	possibly damaging	Het
Lactb	C	G	9: 66,970,692	G285A	probably benign	Het
Lrrc43	T	C	5: 123,501,242	S445P	probably damaging	Het
Maats1	G	A	16: 38,328,374	P231S	probably damaging	Het
Mapk12	T	G	15: 89,135,645	M120L	probably benign	Het
Mroh8	C	G	2: 157,224,036	A669P	probably damaging	Het
Mrpl38	A	C	11: 116,132,018	H373Q	probably benign	Het
Myocd	A	G	11: 65,180,902	V740A	probably damaging	Het
Naprt	A	G	15: 75,892,465	F300S	probably damaging	Het
Ncam2	T	C	16: 81,461,643	I271T	probably damaging	Het
Nek4	A	G	14: 30,980,038	T582A	probably benign	Het
Notch2	C	T	3: 98,070,970	T89I	probably benign	Het
Notch2	G	A	3: 98,111,598	R692H	probably benign	Het
Nt5c3	A	T	6: 56,883,681	N296K	probably damaging	Het
Nt5c3b	T	A	11: 100,436,210	I87F	probably damaging	Het
Oas3	T	C	5: 120,766,144	Q555R	unknown	Het
Olfr1013	T	A	2: 85,769,929	S43T	probably benign	Het
Olfr494	A	T	7: 108,368,231	H247L	probably damaging	Het
Olfr699	A	G	7: 106,790,326	V225A	probably damaging	Het
P3h1	C	A	4: 119,241,530	Q410K	probably benign	Het
Pax3	A	G	1: 78,195,441	V44A	possibly damaging	Het
Pde1c	T	A	6: 56,174,941	L252F	probably damaging	Het
Pdzd7	T	A	19: 45,036,090	T497S	probably benign	Het
Piezo2	T	C	18: 63,022,481	T253A	probably damaging	Het
Pipox	T	C	11: 77,892,139	E79G	probably damaging	Het
Pole	G	T	5: 110,303,593	M829I	probably damaging	Het
Ppp1r12c	A	T	7: 4,489,772	L156Q	probably damaging	Het
Psme2b	T	G	11: 48,945,782	T113P	probably damaging	Het
Ptprq	A	G	10: 107,580,220	I1739T	possibly damaging	Het
Qser1	T	C	2: 104,789,676	T174A	probably damaging	Het
Rcor3	T	G	1: 192,130,436	D81A	probably damaging	Het
Rev3l	T	C	10: 39,848,049	V785A	probably benign	Het
Rnf11	T	C	4: 109,456,922	D90G	probably benign	Het
Sh3tc1	GCCTCCTCCTCCTCCTCC	GCCTCCTCCTCCTCC	5: 35,724,066		probably benign	Het
Smad2	T	A	18: 76,262,552	S21T	probably benign	Het
Smc4	A	G	3: 69,025,888	D639G	probably damaging	Het
Smtn	A	T	11: 3,524,664	S716T	possibly damaging	Het
Smug1	G	T	15: 103,155,709	Q262K	probably benign	Het
Sspo	G	T	6: 48,451,860	G403V	probably benign	Het
Tas2r131	A	G	6: 132,957,451	F132L	possibly damaging	Het
Tgm3	T	C	2: 130,044,662		probably null	Het
Tigd2	C	T	6: 59,210,373	T75M	probably benign	Het
Tnfrsf13b	T	C	11: 61,147,587	V232A	probably benign	Het
Tnfrsf21	C	T	17: 43,038,213	H239Y	probably benign	Het
Trim47	A	G	11: 116,107,890	L301S	probably damaging	Het
Trim75	G	A	8: 64,983,790	H3Y	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Ttc29	G	C	8: 78,276,837	L227F	probably benign	Het
Ttc39d	G	A	17: 80,216,457	D182N	possibly damaging	Het
Ttll10	T	A	4: 156,045,361	R164*	probably null	Het
Ufsp2	T	A	8: 45,996,743	D447E	probably benign	Het
Ugt2b37	T	A	5: 87,251,832	L272F	possibly damaging	Het
Zbbx	T	C	3: 75,081,858	T308A	probably benign	Het
Zfp933	G	A	4: 147,826,462	Q226*	probably null	Het

Other mutations in Vps13b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Vps13b	APN	15	35926226	missense	possibly damaging	0.52
IGL00513:Vps13b	APN	15	35793884	missense	probably damaging	1.00
IGL00516:Vps13b	APN	15	35640557	missense	probably damaging	1.00
IGL00640:Vps13b	APN	15	35417577	missense	probably benign
IGL00753:Vps13b	APN	15	35372031	missense	probably damaging	0.99
IGL00784:Vps13b	APN	15	35846900	missense	probably damaging	1.00
IGL01138:Vps13b	APN	15	35446770	splice site	probably benign
IGL01349:Vps13b	APN	15	35793945	missense	probably benign	0.00
IGL01403:Vps13b	APN	15	35709479	missense	probably benign	0.00
IGL01535:Vps13b	APN	15	35454957	missense	possibly damaging	0.67
IGL01571:Vps13b	APN	15	35877489	splice site	probably benign
IGL01642:Vps13b	APN	15	35792072	missense	probably benign	0.43
IGL01658:Vps13b	APN	15	35671333	missense	probably damaging	0.99
IGL01759:Vps13b	APN	15	35878789	missense	probably damaging	1.00
IGL01763:Vps13b	APN	15	35709799	missense	possibly damaging	0.72
IGL01906:Vps13b	APN	15	35639847	splice site	probably benign
IGL01982:Vps13b	APN	15	35438904	nonsense	probably null
IGL01997:Vps13b	APN	15	35709224	missense	probably damaging	1.00
IGL02041:Vps13b	APN	15	35423245	missense	probably damaging	0.98
IGL02073:Vps13b	APN	15	35875586	missense	possibly damaging	0.52
IGL02077:Vps13b	APN	15	35910613	missense	possibly damaging	0.68
IGL02141:Vps13b	APN	15	35572081	missense	probably benign	0.09
IGL02146:Vps13b	APN	15	35646333	missense	probably benign	0.36
IGL02197:Vps13b	APN	15	35930056	missense	probably benign	0.02
IGL02311:Vps13b	APN	15	35709514	missense	probably benign	0.08
IGL02466:Vps13b	APN	15	35770741	missense	possibly damaging	0.86
IGL02506:Vps13b	APN	15	35917162	missense	probably damaging	1.00
IGL02550:Vps13b	APN	15	35572096	missense	probably benign
IGL02553:Vps13b	APN	15	35646301	missense	probably benign	0.00
IGL02674:Vps13b	APN	15	35639958	missense	probably benign	0.41
IGL02690:Vps13b	APN	15	35917142	missense	probably damaging	1.00
IGL02731:Vps13b	APN	15	35917128	missense	probably benign	0.00
IGL02739:Vps13b	APN	15	35879900	missense	probably damaging	1.00
IGL02868:Vps13b	APN	15	35884519	missense	probably benign	0.03
IGL03081:Vps13b	APN	15	35875820	missense	probably damaging	0.97
IGL03178:Vps13b	APN	15	35869300	missense	probably damaging	1.00
IGL03343:Vps13b	APN	15	35917170	missense	possibly damaging	0.76
IGL03407:Vps13b	APN	15	35639866	missense	possibly damaging	0.95
IGL03410:Vps13b	APN	15	35910340	missense	probably benign
omlette	UTSW	15	35671400	missense	probably benign	0.13
swiss	UTSW	15	35709673	missense	possibly damaging	0.80
FR4449:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4548:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4737:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
FR4976:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
LCD18:Vps13b	UTSW	15	35846957	missense	probably damaging	1.00
PIT4531001:Vps13b	UTSW	15	35878825	missense	probably damaging	1.00
PIT4581001:Vps13b	UTSW	15	35534263	missense	probably damaging	1.00
PIT4618001:Vps13b	UTSW	15	35709240	missense	probably damaging	1.00
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0026:Vps13b	UTSW	15	35923301	missense	possibly damaging	0.62
R0108:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0109:Vps13b	UTSW	15	35572119	missense	probably benign	0.20
R0116:Vps13b	UTSW	15	35423155	missense	probably damaging	0.99
R0123:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0124:Vps13b	UTSW	15	35576528	critical splice donor site	probably null
R0134:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0137:Vps13b	UTSW	15	35926219	missense	probably benign	0.06
R0195:Vps13b	UTSW	15	35471899	missense	probably benign	0.00
R0225:Vps13b	UTSW	15	35887261	missense	probably benign	0.01
R0320:Vps13b	UTSW	15	35674828	missense	probably damaging	0.98
R0333:Vps13b	UTSW	15	35879803	missense	probably damaging	1.00
R0336:Vps13b	UTSW	15	35455133	nonsense	probably null
R0463:Vps13b	UTSW	15	35597409	missense	probably damaging	0.98
R0466:Vps13b	UTSW	15	35445602	nonsense	probably null
R0472:Vps13b	UTSW	15	35417633	critical splice donor site	probably null
R0602:Vps13b	UTSW	15	35422368	missense	probably damaging	1.00
R0612:Vps13b	UTSW	15	35623657	missense	probably benign	0.12
R0627:Vps13b	UTSW	15	35371999	nonsense	probably null
R0679:Vps13b	UTSW	15	35709703	missense	possibly damaging	0.73
R0742:Vps13b	UTSW	15	35794361	missense	probably benign	0.22
R1053:Vps13b	UTSW	15	35652363	missense	probably damaging	1.00
R1355:Vps13b	UTSW	15	35422454	missense	probably damaging	1.00
R1386:Vps13b	UTSW	15	35923312	missense	probably damaging	0.99
R1403:Vps13b	UTSW	15	35709122	splice site	probably benign
R1453:Vps13b	UTSW	15	35422444	missense	probably damaging	0.97
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1464:Vps13b	UTSW	15	35709484	missense	probably benign	0.14
R1511:Vps13b	UTSW	15	35839975	missense	probably damaging	0.99
R1511:Vps13b	UTSW	15	35841573	missense	probably benign	0.00
R1513:Vps13b	UTSW	15	35438730	nonsense	probably null
R1536:Vps13b	UTSW	15	35875566	missense	probably damaging	0.98
R1537:Vps13b	UTSW	15	35792181	missense	possibly damaging	0.62
R1558:Vps13b	UTSW	15	35534319	missense	probably damaging	1.00
R1601:Vps13b	UTSW	15	35642436	missense	probably benign	0.11
R1653:Vps13b	UTSW	15	35607272	nonsense	probably null
R1695:Vps13b	UTSW	15	35576521	missense	probably benign	0.05
R1760:Vps13b	UTSW	15	35884619	missense	possibly damaging	0.54
R1785:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1786:Vps13b	UTSW	15	35879791	missense	probably damaging	1.00
R1803:Vps13b	UTSW	15	35430205	nonsense	probably null
R1804:Vps13b	UTSW	15	35917137	missense	probably damaging	1.00
R1808:Vps13b	UTSW	15	35792059	missense	probably benign	0.00
R1817:Vps13b	UTSW	15	35910642	missense	possibly damaging	0.86
R1818:Vps13b	UTSW	15	35877577	missense	probably benign	0.00
R1836:Vps13b	UTSW	15	35910232	missense	probably damaging	0.99
R1850:Vps13b	UTSW	15	35674959	splice site	probably benign
R1884:Vps13b	UTSW	15	35430291	splice site	probably benign
R1938:Vps13b	UTSW	15	35709507	missense	probably damaging	1.00
R1955:Vps13b	UTSW	15	35925408	critical splice donor site	probably null
R1956:Vps13b	UTSW	15	35869407	missense	probably damaging	1.00
R1958:Vps13b	UTSW	15	35878689	missense	probably damaging	0.99
R2013:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2014:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2015:Vps13b	UTSW	15	35607142	missense	probably damaging	0.99
R2038:Vps13b	UTSW	15	35884741	missense	probably damaging	1.00
R2058:Vps13b	UTSW	15	35841447	missense	probably damaging	1.00
R2082:Vps13b	UTSW	15	35910746	missense	possibly damaging	0.70
R2087:Vps13b	UTSW	15	35597493	missense	probably damaging	0.99
R2124:Vps13b	UTSW	15	35646080	missense	probably benign	0.08
R2130:Vps13b	UTSW	15	35671400	missense	probably benign	0.13
R2168:Vps13b	UTSW	15	35792188	missense	probably damaging	1.00
R2168:Vps13b	UTSW	15	35792189	missense	probably damaging	1.00
R2171:Vps13b	UTSW	15	35887197	missense	probably benign	0.44
R2221:Vps13b	UTSW	15	35884597	missense	probably benign
R2263:Vps13b	UTSW	15	35646181	missense	probably benign	0.02
R2289:Vps13b	UTSW	15	35572105	missense	probably damaging	1.00
R2316:Vps13b	UTSW	15	35674899	nonsense	probably null
R2351:Vps13b	UTSW	15	35869311	missense	probably damaging	1.00
R2512:Vps13b	UTSW	15	35884555	missense	probably benign	0.35
R3054:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3055:Vps13b	UTSW	15	35646361	missense	probably damaging	0.99
R3196:Vps13b	UTSW	15	35869395	missense	probably damaging	1.00
R3236:Vps13b	UTSW	15	35910304	missense	probably benign	0.40
R3404:Vps13b	UTSW	15	35926054	missense	probably damaging	1.00
R3722:Vps13b	UTSW	15	35671382	missense	probably damaging	0.99
R4077:Vps13b	UTSW	15	35455128	missense	probably damaging	0.99
R4153:Vps13b	UTSW	15	35792027	splice site	probably null
R4224:Vps13b	UTSW	15	35876419	missense	probably damaging	0.99
R4408:Vps13b	UTSW	15	35709294	missense	probably damaging	0.98
R4431:Vps13b	UTSW	15	35770753	missense	probably damaging	1.00
R4449:Vps13b	UTSW	15	35876793	missense	possibly damaging	0.86
R4508:Vps13b	UTSW	15	35709673	missense	possibly damaging	0.80
R4631:Vps13b	UTSW	15	35646132	missense	possibly damaging	0.95
R4655:Vps13b	UTSW	15	35770689	missense	probably benign
R4666:Vps13b	UTSW	15	35640544	missense	probably benign	0.13
R4684:Vps13b	UTSW	15	35646178	missense	probably damaging	0.98
R4684:Vps13b	UTSW	15	35841341	missense	probably benign
R4684:Vps13b	UTSW	15	35879821	missense	probably benign
R4721:Vps13b	UTSW	15	35910718	nonsense	probably null
R4771:Vps13b	UTSW	15	35910800	missense	probably damaging	1.00
R4830:Vps13b	UTSW	15	35452224	missense	possibly damaging	0.94
R4835:Vps13b	UTSW	15	35869372	missense	probably damaging	1.00
R4835:Vps13b	UTSW	15	35910293	missense	probably benign
R4857:Vps13b	UTSW	15	35456654	missense	probably benign	0.01
R4891:Vps13b	UTSW	15	35640515	splice site	probably null
R5095:Vps13b	UTSW	15	35923202	missense	probably damaging	1.00
R5110:Vps13b	UTSW	15	35770809	missense	probably damaging	0.99
R5147:Vps13b	UTSW	15	35456678	missense	probably benign	0.32
R5153:Vps13b	UTSW	15	35422453	missense	probably damaging	0.99
R5257:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5258:Vps13b	UTSW	15	35794421	missense	possibly damaging	0.75
R5296:Vps13b	UTSW	15	35876413	missense	probably damaging	1.00
R5386:Vps13b	UTSW	15	35640528	critical splice acceptor site	probably null
R5396:Vps13b	UTSW	15	35886948	missense	probably damaging	0.99
R5412:Vps13b	UTSW	15	35533385	missense	probably damaging	1.00
R5488:Vps13b	UTSW	15	35770542	missense	probably benign
R5489:Vps13b	UTSW	15	35770542	missense	probably benign
R5503:Vps13b	UTSW	15	35452166	missense	probably damaging	0.97
R5575:Vps13b	UTSW	15	35929919	missense	probably damaging	1.00
R5781:Vps13b	UTSW	15	35794035	missense	probably damaging	0.97
R5872:Vps13b	UTSW	15	35869351	missense	possibly damaging	0.56
R5876:Vps13b	UTSW	15	35917061	missense	probably damaging	0.99
R5994:Vps13b	UTSW	15	35875772	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6031:Vps13b	UTSW	15	35471968	missense	probably damaging	1.00
R6045:Vps13b	UTSW	15	35671316	missense	probably damaging	0.99
R6143:Vps13b	UTSW	15	35668738	missense	probably damaging	0.99
R6147:Vps13b	UTSW	15	35930031	missense	probably benign	0.16
R6218:Vps13b	UTSW	15	35770464	missense	probably benign	0.00
R6447:Vps13b	UTSW	15	35572126	missense	probably benign	0.02
R6555:Vps13b	UTSW	15	35846847	missense	probably damaging	1.00
R6578:Vps13b	UTSW	15	35446101	missense	probably damaging	0.99
R6640:Vps13b	UTSW	15	35617696	missense	possibly damaging	0.93
R6645:Vps13b	UTSW	15	35910305	missense	probably benign	0.25
R6711:Vps13b	UTSW	15	35887249	missense	probably damaging	1.00
R6727:Vps13b	UTSW	15	35770683	missense	probably benign	0.19
R6737:Vps13b	UTSW	15	35910611	missense	probably damaging	1.00
R6844:Vps13b	UTSW	15	35877590	missense	probably benign	0.06
R6849:Vps13b	UTSW	15	35905309	missense	probably damaging	1.00
R6861:Vps13b	UTSW	15	35576395	missense	probably damaging	0.99
R6938:Vps13b	UTSW	15	35423198	missense	probably damaging	0.99
R6943:Vps13b	UTSW	15	35448689	missense	possibly damaging	0.95
R6989:Vps13b	UTSW	15	35448581	missense	probably benign	0.02
R7092:Vps13b	UTSW	15	35640634	missense	probably damaging	1.00
R7232:Vps13b	UTSW	15	35877557	missense	probably damaging	1.00
R7307:Vps13b	UTSW	15	35841545	missense	probably benign
R7400:Vps13b	UTSW	15	35378900	missense	probably damaging	1.00
R7414:Vps13b	UTSW	15	35910827	missense	probably damaging	1.00
R7497:Vps13b	UTSW	15	35876697	missense	probably benign	0.38
R7500:Vps13b	UTSW	15	35910524	missense	possibly damaging	0.74
R7603:Vps13b	UTSW	15	35576439	missense	probably damaging	0.98
R7605:Vps13b	UTSW	15	35770646	missense	probably damaging	0.97
R7849:Vps13b	UTSW	15	35423232	missense	probably damaging	0.99
R7984:Vps13b	UTSW	15	35879913	missense	probably benign
R8094:Vps13b	UTSW	15	35668906	critical splice donor site	probably null
R8097:Vps13b	UTSW	15	35709346	missense	probably benign	0.38
R8131:Vps13b	UTSW	15	35372109	critical splice donor site	probably null
R8139:Vps13b	UTSW	15	35607272	nonsense	probably null
R8174:Vps13b	UTSW	15	35709310	nonsense	probably null
R8225:Vps13b	UTSW	15	35794382	missense	probably damaging	0.99
R8239:Vps13b	UTSW	15	35597404	missense	probably damaging	1.00
R8244:Vps13b	UTSW	15	35917203	missense	probably damaging	1.00
R8303:Vps13b	UTSW	15	35639917	missense	probably damaging	1.00
R8311:Vps13b	UTSW	15	35886954	missense	probably benign	0.37
R8443:Vps13b	UTSW	15	35455100	missense	probably benign
R8494:Vps13b	UTSW	15	35422448	missense	probably damaging	0.99
R8499:Vps13b	UTSW	15	35841320	missense	probably damaging	1.00
R8506:Vps13b	UTSW	15	35446745	missense	probably benign	0.31
R8559:Vps13b	UTSW	15	35876642	missense	probably damaging	1.00
R8686:Vps13b	UTSW	15	35925389	missense	probably damaging	0.99
R8782:Vps13b	UTSW	15	35422337	missense	possibly damaging	0.93
R8806:Vps13b	UTSW	15	35472066	critical splice donor site	probably benign
R8824:Vps13b	UTSW	15	35533299	missense	probably damaging	0.99
R9024:Vps13b	UTSW	15	35923324	missense	probably damaging	0.97
R9038:Vps13b	UTSW	15	35875785	missense	possibly damaging	0.70
R9054:Vps13b	UTSW	15	35422391	missense	probably damaging	1.00
R9091:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9129:Vps13b	UTSW	15	35448647	missense	probably damaging	1.00
R9214:Vps13b	UTSW	15	35623746	missense	probably damaging	0.99
R9237:Vps13b	UTSW	15	35841333	missense	probably damaging	1.00
R9256:Vps13b	UTSW	15	35623779	missense	possibly damaging	0.95
R9270:Vps13b	UTSW	15	35770773	missense	probably benign	0.13
R9279:Vps13b	UTSW	15	35572144	missense	probably damaging	0.97
R9291:Vps13b	UTSW	15	35846913	missense	probably damaging	1.00
R9342:Vps13b	UTSW	15	35455054	missense	possibly damaging	0.94
R9404:Vps13b	UTSW	15	35876419	missense	probably damaging	1.00
R9488:Vps13b	UTSW	15	35447734	missense	possibly damaging	0.77
R9509:Vps13b	UTSW	15	35841311	missense	possibly damaging	0.79
R9610:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9611:Vps13b	UTSW	15	35642409	missense	possibly damaging	0.85
R9658:Vps13b	UTSW	15	35623628	missense	probably benign	0.00
R9674:Vps13b	UTSW	15	35607234	missense	probably damaging	0.98
R9696:Vps13b	UTSW	15	35674887	missense	possibly damaging	0.56
R9767:Vps13b	UTSW	15	35910257	missense	probably damaging	1.00
R9797:Vps13b	UTSW	15	35674876	missense	probably damaging	1.00
RF020:Vps13b	UTSW	15	35925406	missense	probably null	1.00
X0026:Vps13b	UTSW	15	35910646	missense	probably damaging	1.00
X0028:Vps13b	UTSW	15	35709431	missense	probably benign	0.00
Z1177:Vps13b	UTSW	15	35668885	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACAAACCATGTGAATGTATACCTTTCCCC -3'
(R):5'- GCAAACAAATGTCCTCCCTGTCTACT -3'

Sequencing Primer
(F):5'- ACAGTTCCTCTAGTATGTTGTGC -3'
(R):5'- aataaaaaaaaaaaagcagcccaaag -3'

Posted On

2013-06-12