Mutagenetix > Incidental Mutation

Incidental Mutation 'R6126:Ggcx'

487390

Institutional Source

Beutler Lab

Gene Symbol

Ggcx

Ensembl Gene

ENSMUSG00000053460

Gene Name

gamma-glutamyl carboxylase

Synonyms

vitamin K-dependent carboxylase

MMRRC Submission

044273-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.836) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72414308-72430712 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 72417983 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 115 (M115L)

Ref Sequence

ENSEMBL: ENSMUSP00000070109 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000065906] [ENSMUST00000205738]

AlphaFold

Q9QYC7

Predicted Effect

possibly damaging
Transcript: ENSMUST00000065906
AA Change: M115L

PolyPhen 2 Score 0.573 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000070109
Gene: ENSMUSG00000053460
AA Change: M115L

Domain	Start	End	E-Value	Type
HTTM	56	315	1.34e-131	SMART
low complexity region	368	377	N/A	INTRINSIC
low complexity region	630	645	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000132995
AA Change: M26L

Predicted Effect

probably benign
Transcript: ENSMUST00000205738

Predicted Effect

unknown
Transcript: ENSMUST00000207012
AA Change: I43F

Meta Mutation Damage Score

0.2774

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein of the rough endoplasmic reticulum that carboxylates glutamate residues of vitamin K-dependent proteins to gamma carboxyl glutamate, a modification that is required for their activity. The vitamin K-dependent protein substrates have a propeptide that binds the enzyme, with carbon dioxide, dioxide, and reduced vitamin K acting as co-substrates. Vitamin K-dependent proteins affect a number of physiologic processes including blood coagulation, prevention of vascular calcification, and inflammation. Allelic variants of this gene have been associated with pseudoxanthoma elasticum-like disorder with associated multiple coagulation factor deficiency. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Approximately 50% of embryos homozygous for a knock-out allele die between E9.5 and E18 while those surviving to term die of massive intra-abdominal hemorrhage shortly after birth with no evidence of ectopic calcification. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Ggcx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01657:Ggcx	APN	6	72429958	splice site	probably null
IGL02373:Ggcx	APN	6	72427919	missense	probably damaging	1.00
IGL02589:Ggcx	APN	6	72429148	missense	probably damaging	1.00
IGL02634:Ggcx	APN	6	72418303	missense	probably damaging	1.00
IGL02661:Ggcx	APN	6	72418360	missense	possibly damaging	0.78
IGL02701:Ggcx	APN	6	72418472	intron	probably benign
R0503:Ggcx	UTSW	6	72429157	frame shift	probably null
R1034:Ggcx	UTSW	6	72414831	missense	probably damaging	1.00
R2219:Ggcx	UTSW	6	72427982	missense	probably benign	0.29
R3892:Ggcx	UTSW	6	72418372	missense	probably damaging	0.99
R3951:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R3952:Ggcx	UTSW	6	72426558	missense	probably benign	0.01
R4320:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4321:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4322:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4324:Ggcx	UTSW	6	72428820	missense	probably benign	0.24
R4782:Ggcx	UTSW	6	72428892	missense	probably benign	0.01
R5370:Ggcx	UTSW	6	72425931	missense	possibly damaging	0.69
R5523:Ggcx	UTSW	6	72424034	missense	probably damaging	1.00
R5902:Ggcx	UTSW	6	72429996	missense	possibly damaging	0.92
R6199:Ggcx	UTSW	6	72430139	missense	possibly damaging	0.57
R6223:Ggcx	UTSW	6	72429605	missense	probably damaging	0.97
R6515:Ggcx	UTSW	6	72425832	missense	probably benign	0.33
R7205:Ggcx	UTSW	6	72428004	missense	probably damaging	1.00
R7923:Ggcx	UTSW	6	72427917	missense	probably damaging	1.00
R8034:Ggcx	UTSW	6	72428604	missense	possibly damaging	0.47
R8096:Ggcx	UTSW	6	72429993	missense	probably benign	0.33
R8116:Ggcx	UTSW	6	72429528	missense	possibly damaging	0.66
R8356:Ggcx	UTSW	6	72429591	missense	probably benign	0.03
R8977:Ggcx	UTSW	6	72429282	critical splice donor site	probably null
R9074:Ggcx	UTSW	6	72425941	missense	probably damaging	1.00
R9145:Ggcx	UTSW	6	72425922	missense	probably benign	0.18
R9285:Ggcx	UTSW	6	72418419	nonsense	probably null
R9362:Ggcx	UTSW	6	72428032	missense	probably damaging	1.00
R9497:Ggcx	UTSW	6	72429207	missense	probably damaging	1.00
Z1177:Ggcx	UTSW	6	72426519	missense	probably benign	0.19

Predicted Primers

PCR Primer
(F):5'- TAGAGCTGTGTCTTGCTTCC -3'
(R):5'- TCAGGCAGAGAGCTACATGG -3'

Sequencing Primer
(F):5'- TTCCTCGGTGGCTGCCTG -3'
(R):5'- GGTCATGACGACTCATATGATACAC -3'

Posted On

2017-10-10