Mutagenetix > Incidental Mutation

Incidental Mutation 'R6126:Slc4a5'

487391

Institutional Source

Beutler Lab

Gene Symbol

Slc4a5

Ensembl Gene

ENSMUSG00000068323

Gene Name

solute carrier family 4, sodium bicarbonate cotransporter, member 5

Synonyms

C330016K18Rik

MMRRC Submission

044273-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.201) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

83219828-83304945 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 83226265 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Leucine at position 49 (H49L)

Ref Sequence

ENSEMBL: ENSMUSP00000109533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113900]

AlphaFold

E9Q3M5

Predicted Effect

probably benign
Transcript: ENSMUST00000113900
AA Change: H49L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000109533
Gene: ENSMUSG00000068323
AA Change: H49L

Domain	Start	End	E-Value	Type
Pfam:Band_3_cyto	140	407	3.4e-106	PFAM
low complexity region	436	465	N/A	INTRINSIC
Pfam:HCO3_cotransp	480	999	1.6e-224	PFAM
transmembrane domain	1006	1028	N/A	INTRINSIC
low complexity region	1051	1066	N/A	INTRINSIC

Meta Mutation Damage Score

0.1340

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the sodium bicarbonate cotransporter (NBC) family, part of the bicarbonate transporter superfamily. Sodium bicarbonate cotransporters are involved in intracellular pH regulation and electroneural or electrogenic sodium bicarbonate transport. This protein is thought to be an integral membrane protein. Multiple transcript variants encoding different isoforms have been found for this gene, but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit arterial hypertension and renal metabolic acidosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Slc4a5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00235:Slc4a5	APN	6	83285899	missense	probably damaging	1.00
IGL00473:Slc4a5	APN	6	83296597	missense	probably damaging	1.00
IGL00861:Slc4a5	APN	6	83299471	missense	probably benign
IGL01025:Slc4a5	APN	6	83262533	missense	probably damaging	0.98
IGL01532:Slc4a5	APN	6	83273040	splice site	probably null
IGL01991:Slc4a5	APN	6	83263543	missense	possibly damaging	0.94
IGL02271:Slc4a5	APN	6	83271103	splice site	probably benign
IGL02565:Slc4a5	APN	6	83299505	missense	probably benign	0.00
IGL02669:Slc4a5	APN	6	83263543	missense	possibly damaging	0.79
IGL02994:Slc4a5	APN	6	83272124	missense	probably damaging	1.00
IGL03259:Slc4a5	APN	6	83270997	missense	probably damaging	1.00
IGL03264:Slc4a5	APN	6	83261525	missense	probably damaging	1.00
R0032:Slc4a5	UTSW	6	83273157	missense	probably damaging	1.00
R0091:Slc4a5	UTSW	6	83277555	missense	probably benign	0.00
R0281:Slc4a5	UTSW	6	83267567	splice site	probably benign
R0366:Slc4a5	UTSW	6	83295872	missense	probably benign	0.02
R0668:Slc4a5	UTSW	6	83271072	missense	probably damaging	1.00
R1222:Slc4a5	UTSW	6	83280132	missense	probably damaging	1.00
R1550:Slc4a5	UTSW	6	83271057	missense	probably damaging	1.00
R1585:Slc4a5	UTSW	6	83265687	missense	probably damaging	1.00
R1731:Slc4a5	UTSW	6	83296635	missense	probably damaging	1.00
R1987:Slc4a5	UTSW	6	83273232	missense	possibly damaging	0.95
R2103:Slc4a5	UTSW	6	83224681	missense	probably benign	0.00
R2103:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2104:Slc4a5	UTSW	6	83297378	missense	probably benign	0.00
R2176:Slc4a5	UTSW	6	83262560	missense	probably damaging	0.98
R2920:Slc4a5	UTSW	6	83264387	missense	probably damaging	1.00
R2964:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2965:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R2966:Slc4a5	UTSW	6	83296669	missense	probably damaging	1.00
R3755:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R3756:Slc4a5	UTSW	6	83288303	missense	probably benign	0.26
R4293:Slc4a5	UTSW	6	83260529	missense	probably damaging	1.00
R4789:Slc4a5	UTSW	6	83270969	missense	probably benign	0.05
R4823:Slc4a5	UTSW	6	83272133	missense	probably damaging	1.00
R4854:Slc4a5	UTSW	6	83271017	missense	probably benign	0.00
R5461:Slc4a5	UTSW	6	83285854	missense	probably benign	0.29
R5707:Slc4a5	UTSW	6	83261415	missense	probably benign	0.11
R5747:Slc4a5	UTSW	6	83271029	missense	probably damaging	1.00
R5978:Slc4a5	UTSW	6	83277536	missense	probably benign	0.01
R6330:Slc4a5	UTSW	6	83226374	missense	probably benign
R6564:Slc4a5	UTSW	6	83280060	missense	possibly damaging	0.71
R6786:Slc4a5	UTSW	6	83296747	critical splice donor site	probably null
R7443:Slc4a5	UTSW	6	83264315	missense	probably benign	0.45
R7672:Slc4a5	UTSW	6	83260535	missense	probably damaging	1.00
R7690:Slc4a5	UTSW	6	83285872	missense	probably damaging	1.00
R7837:Slc4a5	UTSW	6	83261557	missense	probably benign	0.01
R8169:Slc4a5	UTSW	6	83303391	missense	probably benign	0.12
R8288:Slc4a5	UTSW	6	83226255	missense	probably benign	0.01
R8397:Slc4a5	UTSW	6	83289326	critical splice donor site	probably null
R8849:Slc4a5	UTSW	6	83273198	missense	probably damaging	1.00
R9033:Slc4a5	UTSW	6	83260475	nonsense	probably null
R9133:Slc4a5	UTSW	6	83226235	missense	possibly damaging	0.85
R9201:Slc4a5	UTSW	6	83285830	missense	probably benign	0.02
R9269:Slc4a5	UTSW	6	83289241	missense	possibly damaging	0.88
R9603:Slc4a5	UTSW	6	83240732	missense	probably benign	0.34
R9781:Slc4a5	UTSW	6	83262484	missense	probably benign	0.00
Z1177:Slc4a5	UTSW	6	83280033	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCCTTGTATTCTGACAGAACC -3'
(R):5'- CTGTACCCACCAACAGGTTG -3'

Sequencing Primer
(F):5'- GTATTCTGACAGAACCTTCATCCCAG -3'
(R):5'- TGGCTCTTGAAGGAACATGCC -3'

Posted On

2017-10-10