Incidental Mutation 'R6126:Ppp6r1'
ID487392
Institutional Source Beutler Lab
Gene Symbol Ppp6r1
Ensembl Gene ENSMUSG00000052296
Gene Nameprotein phosphatase 6, regulatory subunit 1
SynonymsB430201G11Rik, Saps1, 2010309P17Rik, Pp6r1
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location4631495-4659019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4643377 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 136 (T136A)
Ref Sequence ENSEMBL: ENSMUSP00000066736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064099] [ENSMUST00000205374] [ENSMUST00000206532]
Predicted Effect possibly damaging
Transcript: ENSMUST00000064099
AA Change: T136A

PolyPhen 2 Score 0.479 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000066736
Gene: ENSMUSG00000052296
AA Change: T136A

DomainStartEndE-ValueType
low complexity region 16 36 N/A INTRINSIC
Pfam:SAPS 128 378 4.6e-69 PFAM
Pfam:SAPS 372 519 1.8e-39 PFAM
low complexity region 525 536 N/A INTRINSIC
low complexity region 618 639 N/A INTRINSIC
low complexity region 669 681 N/A INTRINSIC
low complexity region 692 707 N/A INTRINSIC
low complexity region 842 855 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205374
AA Change: T136A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206307
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206391
Predicted Effect probably benign
Transcript: ENSMUST00000206532
AA Change: T146A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206768
Predicted Effect probably benign
Transcript: ENSMUST00000206966
Meta Mutation Damage Score 0.1623 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS1, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS1 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ppp6r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Ppp6r1 APN 7 4639987 splice site probably null
IGL02232:Ppp6r1 APN 7 4633342 missense probably damaging 0.98
IGL02674:Ppp6r1 APN 7 4646813 missense probably damaging 1.00
IGL02887:Ppp6r1 APN 7 4642212 missense probably damaging 1.00
IGL02990:Ppp6r1 APN 7 4643023 missense possibly damaging 0.83
IGL03135:Ppp6r1 APN 7 4642160 missense possibly damaging 0.90
IGL03399:Ppp6r1 APN 7 4643252 missense probably damaging 1.00
R0375:Ppp6r1 UTSW 7 4633287 missense probably benign 0.00
R0412:Ppp6r1 UTSW 7 4642214 missense probably damaging 0.98
R0760:Ppp6r1 UTSW 7 4639723 missense probably benign 0.00
R0883:Ppp6r1 UTSW 7 4639710 missense possibly damaging 0.89
R1478:Ppp6r1 UTSW 7 4640378 splice site probably null
R1515:Ppp6r1 UTSW 7 4643258 missense probably damaging 0.97
R1768:Ppp6r1 UTSW 7 4633692 critical splice donor site probably null
R1772:Ppp6r1 UTSW 7 4642031 missense probably benign 0.00
R4017:Ppp6r1 UTSW 7 4633744 missense probably benign 0.07
R4519:Ppp6r1 UTSW 7 4641046 unclassified probably null
R4795:Ppp6r1 UTSW 7 4641054 missense possibly damaging 0.66
R4849:Ppp6r1 UTSW 7 4643207 missense probably damaging 1.00
R5214:Ppp6r1 UTSW 7 4643177 missense probably benign 0.00
R5416:Ppp6r1 UTSW 7 4639748 missense possibly damaging 0.96
R5643:Ppp6r1 UTSW 7 4633772 missense probably benign 0.30
R5765:Ppp6r1 UTSW 7 4642208 missense possibly damaging 0.67
R6854:Ppp6r1 UTSW 7 4632396 missense probably benign 0.02
R6932:Ppp6r1 UTSW 7 4633292 missense possibly damaging 0.84
R7011:Ppp6r1 UTSW 7 4646826 missense probably damaging 1.00
R7486:Ppp6r1 UTSW 7 4639900 missense probably benign 0.17
R7500:Ppp6r1 UTSW 7 4636130 missense probably benign 0.04
X0062:Ppp6r1 UTSW 7 4640307 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACATTGAAGACATCCTGCCG -3'
(R):5'- TGTAGCCTGTGAAATCCTGACC -3'

Sequencing Primer
(F):5'- TGAGGCCGCTCCACACAAG -3'
(R):5'- GTGAAATCCTGACCTCTGATGTGC -3'
Posted On2017-10-10