Incidental Mutation 'R6126:Olfr530'
ID487398
Institutional Source Beutler Lab
Gene Symbol Olfr530
Ensembl Gene ENSMUSG00000060974
Gene Nameolfactory receptor 530
SynonymsGA_x6K02T2PBJ9-42523824-42522901, MOR252-2
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location140371872-140376331 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 140373253 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 119 (Y119S)
Ref Sequence ENSEMBL: ENSMUSP00000149475 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074177] [ENSMUST00000216727]
Predicted Effect probably damaging
Transcript: ENSMUST00000074177
AA Change: Y119S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000073808
Gene: ENSMUSG00000060974
AA Change: Y119S

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 4.8e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.8e-6 PFAM
Pfam:7tm_1 41 289 1.4e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211097
Predicted Effect probably damaging
Transcript: ENSMUST00000216727
AA Change: Y119S

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Meta Mutation Damage Score 0.2012 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Olfr530
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Olfr530 APN 7 140373185 missense probably benign 0.01
IGL01785:Olfr530 APN 7 140373125 missense probably benign
IGL01786:Olfr530 APN 7 140373125 missense probably benign
IGL03087:Olfr530 APN 7 140373092 missense probably damaging 1.00
R0543:Olfr530 UTSW 7 140373394 missense probably benign 0.07
R0634:Olfr530 UTSW 7 140373397 missense possibly damaging 0.88
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1470:Olfr530 UTSW 7 140373113 missense probably benign 0.03
R1553:Olfr530 UTSW 7 140373038 missense probably damaging 1.00
R1702:Olfr530 UTSW 7 140372742 nonsense probably null
R1767:Olfr530 UTSW 7 140373476 missense possibly damaging 0.95
R2379:Olfr530 UTSW 7 140372835 nonsense probably null
R4243:Olfr530 UTSW 7 140372944 missense probably benign 0.01
R4281:Olfr530 UTSW 7 140373472 missense probably benign 0.10
R4717:Olfr530 UTSW 7 140373415 missense probably damaging 0.99
R4923:Olfr530 UTSW 7 140373007 missense probably benign 0.11
R5763:Olfr530 UTSW 7 140373655 critical splice acceptor site probably null
R6528:Olfr530 UTSW 7 140373441 missense possibly damaging 0.81
R7469:Olfr530 UTSW 7 140373137 missense possibly damaging 0.93
R8081:Olfr530 UTSW 7 140373059 missense probably damaging 1.00
Z1177:Olfr530 UTSW 7 140372803 missense probably benign 0.21
Predicted Primers PCR Primer
(F):5'- GTGTGATGAGATTGGGACCAC -3'
(R):5'- AATGGCCTGATCATCGCAAC -3'

Sequencing Primer
(F):5'- TTGGGACCACAGAAAGACAATG -3'
(R):5'- GCCTGATCATCGCAACCATCC -3'
Posted On2017-10-10