Incidental Mutation 'R6126:Tex15'
ID 487400
Institutional Source Beutler Lab
Gene Symbol Tex15
Ensembl Gene ENSMUSG00000009628
Gene Name testis expressed gene 15
Synonyms 2210014E14Rik
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.291) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 34006766-34075610 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 34063591 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Serine at position 1007 (N1007S)
Ref Sequence ENSEMBL: ENSMUSP00000009772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009772] [ENSMUST00000124496] [ENSMUST00000124501]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000009772
AA Change: N1007S

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000009772
Gene: ENSMUSG00000009628
AA Change: N1007S

DomainStartEndE-ValueType
low complexity region 262 274 N/A INTRINSIC
low complexity region 302 313 N/A INTRINSIC
low complexity region 524 536 N/A INTRINSIC
low complexity region 665 674 N/A INTRINSIC
low complexity region 713 725 N/A INTRINSIC
low complexity region 946 961 N/A INTRINSIC
low complexity region 1497 1508 N/A INTRINSIC
Pfam:TEX15 1572 1788 1.3e-109 PFAM
Pfam:TEX15 1901 2119 1.1e-16 PFAM
low complexity region 2758 2770 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124496
SMART Domains Protein: ENSMUSP00000120744
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 89 251 1.6e-58 PFAM
low complexity region 536 548 N/A INTRINSIC
low complexity region 576 587 N/A INTRINSIC
low complexity region 798 810 N/A INTRINSIC
low complexity region 939 948 N/A INTRINSIC
low complexity region 987 999 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124501
SMART Domains Protein: ENSMUSP00000138070
Gene: ENSMUSG00000009628

DomainStartEndE-ValueType
Pfam:DUF3715 96 251 2.4e-52 PFAM
Meta Mutation Damage Score 0.0894 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype PHENOTYPE: Male mice are infertile due to arrest of meiosis stemming from failure to repair double-strand breaks. However, female mice are fertile. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)

Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 89,963,881 (GRCm39) R111H probably damaging Het
Alk G A 17: 72,182,037 (GRCm39) L1329F possibly damaging Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
Atp8a2 C T 14: 60,281,775 (GRCm39) M126I probably benign Het
Cactin G A 10: 81,160,143 (GRCm39) R412H possibly damaging Het
Chd7 T C 4: 8,826,482 (GRCm39) S949P probably damaging Het
Clec11a C T 7: 43,954,345 (GRCm39) A203T probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dst T A 1: 34,267,264 (GRCm39) I5080K probably damaging Het
Ecd T C 14: 20,388,493 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fan1 T A 7: 64,014,318 (GRCm39) K638* probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fig4 A G 10: 41,141,443 (GRCm39) I272T probably damaging Het
Foxd2 C A 4: 114,765,702 (GRCm39) G106V unknown Het
Ggcx A T 6: 72,394,966 (GRCm39) M115L possibly damaging Het
Gm21976 G A 13: 98,423,821 (GRCm39) R72H unknown Het
Hsf2 T C 10: 57,372,013 (GRCm39) V38A probably damaging Het
Ifi208 A G 1: 173,505,274 (GRCm39) Y8C possibly damaging Het
Il31ra A C 13: 112,666,908 (GRCm39) L390R probably damaging Het
Kif1a A T 1: 92,947,621 (GRCm39) Y1614N probably damaging Het
Mef2b C A 8: 70,619,526 (GRCm39) T267K probably benign Het
Mfsd8 A G 3: 40,786,446 (GRCm39) probably null Het
Mnx1 G T 5: 29,683,110 (GRCm39) A55E possibly damaging Het
Muc5ac A T 7: 141,354,969 (GRCm39) I949F possibly damaging Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Ntpcr G A 8: 126,462,626 (GRCm39) probably null Het
Or12j3 T G 7: 139,953,166 (GRCm39) Y119S probably damaging Het
Otx1 T C 11: 21,946,457 (GRCm39) probably benign Het
Panx1 T A 9: 14,919,086 (GRCm39) I258F probably benign Het
Pask T C 1: 93,242,081 (GRCm39) Y1212C probably damaging Het
Pdgfra A G 5: 75,331,190 (GRCm39) K265R probably benign Het
Phf20l1 A G 15: 66,508,673 (GRCm39) H844R probably benign Het
Ppp6r1 T C 7: 4,646,376 (GRCm39) T136A possibly damaging Het
Rab35 A G 5: 115,783,767 (GRCm39) N185D probably benign Het
Rdh1 A T 10: 127,599,083 (GRCm39) D188V probably damaging Het
Rimbp3 A T 16: 17,030,140 (GRCm39) D1188V probably benign Het
Robo2 C T 16: 73,717,570 (GRCm39) G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr1 A C 7: 28,775,664 (GRCm39) D2282E probably null Het
Ryr3 A G 2: 112,588,015 (GRCm39) L2642P probably damaging Het
Sez6 A T 11: 77,864,630 (GRCm39) Y530F probably damaging Het
Slc12a2 A G 18: 58,077,116 (GRCm39) Y1205C possibly damaging Het
Slc4a5 A T 6: 83,203,247 (GRCm39) H49L probably benign Het
Smchd1 A T 17: 71,677,280 (GRCm39) V1503D probably damaging Het
Spata31e3 G T 13: 50,400,326 (GRCm39) Q667K probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tpk1 A T 6: 43,400,594 (GRCm39) C143S probably damaging Het
Wdr20 A T 12: 110,760,536 (GRCm39) H474L probably benign Het
Wnk4 A G 11: 101,167,174 (GRCm39) probably benign Het
Zfp292 T C 4: 34,808,497 (GRCm39) T1516A probably benign Het
Zfp462 G A 4: 55,023,573 (GRCm39) A2121T probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Tex15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Tex15 APN 8 34,065,339 (GRCm39) missense probably benign 0.18
IGL00705:Tex15 APN 8 34,071,620 (GRCm39) missense probably damaging 1.00
IGL00820:Tex15 APN 8 34,069,034 (GRCm39) splice site probably benign
IGL01288:Tex15 APN 8 34,061,412 (GRCm39) missense probably benign 0.02
IGL01328:Tex15 APN 8 34,061,424 (GRCm39) nonsense probably null
IGL01359:Tex15 APN 8 34,071,926 (GRCm39) missense probably damaging 0.99
IGL01603:Tex15 APN 8 34,063,575 (GRCm39) missense possibly damaging 0.93
IGL01861:Tex15 APN 8 34,060,717 (GRCm39) missense probably damaging 1.00
IGL02052:Tex15 APN 8 34,072,493 (GRCm39) missense probably benign 0.28
IGL02560:Tex15 APN 8 34,071,779 (GRCm39) missense probably benign 0.00
IGL02677:Tex15 APN 8 34,061,108 (GRCm39) missense probably benign 0.03
IGL02739:Tex15 APN 8 34,071,721 (GRCm39) missense possibly damaging 0.68
Big_gulp UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
P0005:Tex15 UTSW 8 34,060,896 (GRCm39) missense probably benign 0.00
P0037:Tex15 UTSW 8 34,071,608 (GRCm39) missense probably benign 0.00
PIT4377001:Tex15 UTSW 8 34,061,129 (GRCm39) missense probably damaging 1.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0056:Tex15 UTSW 8 34,072,055 (GRCm39) missense probably benign 0.00
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0058:Tex15 UTSW 8 34,071,530 (GRCm39) splice site probably benign
R0595:Tex15 UTSW 8 34,062,645 (GRCm39) missense probably damaging 1.00
R0646:Tex15 UTSW 8 34,072,354 (GRCm39) missense possibly damaging 0.83
R0688:Tex15 UTSW 8 34,063,528 (GRCm39) missense probably damaging 1.00
R0842:Tex15 UTSW 8 34,061,575 (GRCm39) missense possibly damaging 0.95
R0987:Tex15 UTSW 8 34,066,875 (GRCm39) missense probably damaging 1.00
R1084:Tex15 UTSW 8 34,067,032 (GRCm39) missense probably benign 0.28
R1183:Tex15 UTSW 8 34,064,893 (GRCm39) missense probably benign 0.35
R1186:Tex15 UTSW 8 34,061,661 (GRCm39) missense probably benign 0.19
R1378:Tex15 UTSW 8 34,065,244 (GRCm39) missense probably damaging 0.99
R1500:Tex15 UTSW 8 34,065,120 (GRCm39) missense probably damaging 0.96
R1508:Tex15 UTSW 8 34,066,880 (GRCm39) missense probably damaging 1.00
R1597:Tex15 UTSW 8 34,061,511 (GRCm39) missense probably damaging 0.96
R1636:Tex15 UTSW 8 34,066,415 (GRCm39) nonsense probably null
R1639:Tex15 UTSW 8 34,060,845 (GRCm39) missense possibly damaging 0.94
R1809:Tex15 UTSW 8 34,064,262 (GRCm39) missense probably benign
R1843:Tex15 UTSW 8 34,066,682 (GRCm39) missense probably benign 0.27
R2029:Tex15 UTSW 8 34,061,302 (GRCm39) missense probably damaging 0.99
R2228:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2229:Tex15 UTSW 8 34,061,265 (GRCm39) missense probably benign 0.05
R2245:Tex15 UTSW 8 34,061,524 (GRCm39) missense possibly damaging 0.77
R2246:Tex15 UTSW 8 34,072,540 (GRCm39) missense possibly damaging 0.49
R2880:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2881:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R2882:Tex15 UTSW 8 34,064,935 (GRCm39) nonsense probably null
R3001:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3002:Tex15 UTSW 8 34,064,556 (GRCm39) missense probably benign 0.15
R3020:Tex15 UTSW 8 34,066,698 (GRCm39) missense probably damaging 1.00
R3084:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3085:Tex15 UTSW 8 34,064,913 (GRCm39) missense probably benign 0.11
R3701:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3702:Tex15 UTSW 8 34,064,194 (GRCm39) missense probably benign 0.00
R3752:Tex15 UTSW 8 34,061,443 (GRCm39) missense probably benign
R4162:Tex15 UTSW 8 34,071,586 (GRCm39) missense probably damaging 1.00
R4231:Tex15 UTSW 8 34,062,165 (GRCm39) missense probably damaging 0.99
R4589:Tex15 UTSW 8 34,047,401 (GRCm39) missense probably damaging 1.00
R4707:Tex15 UTSW 8 34,072,525 (GRCm39) missense probably benign 0.00
R4773:Tex15 UTSW 8 34,072,760 (GRCm39) missense probably benign 0.42
R4967:Tex15 UTSW 8 34,064,498 (GRCm39) missense probably benign 0.34
R5063:Tex15 UTSW 8 34,072,638 (GRCm39) missense possibly damaging 0.59
R5121:Tex15 UTSW 8 34,061,794 (GRCm39) missense probably damaging 1.00
R5147:Tex15 UTSW 8 34,062,340 (GRCm39) nonsense probably null
R5166:Tex15 UTSW 8 34,066,420 (GRCm39) missense probably benign 0.07
R5173:Tex15 UTSW 8 34,061,768 (GRCm39) missense possibly damaging 0.73
R5439:Tex15 UTSW 8 34,064,199 (GRCm39) missense possibly damaging 0.93
R5537:Tex15 UTSW 8 34,061,641 (GRCm39) missense probably damaging 1.00
R5580:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R5588:Tex15 UTSW 8 34,067,215 (GRCm39) missense probably damaging 1.00
R5696:Tex15 UTSW 8 34,063,220 (GRCm39) missense probably benign 0.01
R5734:Tex15 UTSW 8 34,036,364 (GRCm39) missense probably benign 0.01
R5756:Tex15 UTSW 8 34,065,861 (GRCm39) missense probably benign 0.17
R5823:Tex15 UTSW 8 34,060,962 (GRCm39) missense possibly damaging 0.67
R6129:Tex15 UTSW 8 34,064,158 (GRCm39) missense possibly damaging 0.90
R6276:Tex15 UTSW 8 34,067,217 (GRCm39) missense possibly damaging 0.93
R6374:Tex15 UTSW 8 34,065,940 (GRCm39) missense probably damaging 1.00
R6430:Tex15 UTSW 8 34,061,329 (GRCm39) missense probably benign 0.01
R6452:Tex15 UTSW 8 34,062,844 (GRCm39) missense probably damaging 1.00
R6471:Tex15 UTSW 8 34,071,762 (GRCm39) missense probably damaging 1.00
R6700:Tex15 UTSW 8 34,064,917 (GRCm39) missense possibly damaging 0.93
R6918:Tex15 UTSW 8 34,063,212 (GRCm39) missense probably benign 0.27
R6958:Tex15 UTSW 8 34,060,899 (GRCm39) missense probably benign 0.01
R6970:Tex15 UTSW 8 34,047,456 (GRCm39) missense probably benign 0.03
R7059:Tex15 UTSW 8 34,064,758 (GRCm39) missense possibly damaging 0.57
R7069:Tex15 UTSW 8 34,060,748 (GRCm39) missense probably benign
R7072:Tex15 UTSW 8 34,065,459 (GRCm39) missense possibly damaging 0.85
R7212:Tex15 UTSW 8 34,063,023 (GRCm39) missense probably damaging 1.00
R7212:Tex15 UTSW 8 34,060,854 (GRCm39) nonsense probably null
R7216:Tex15 UTSW 8 34,063,014 (GRCm39) missense possibly damaging 0.93
R7219:Tex15 UTSW 8 34,036,268 (GRCm39) missense probably benign 0.40
R7313:Tex15 UTSW 8 34,064,845 (GRCm39) missense possibly damaging 0.82
R7315:Tex15 UTSW 8 34,071,544 (GRCm39) missense probably benign 0.01
R7444:Tex15 UTSW 8 34,066,590 (GRCm39) missense possibly damaging 0.92
R7455:Tex15 UTSW 8 34,067,025 (GRCm39) missense possibly damaging 0.91
R7643:Tex15 UTSW 8 34,065,148 (GRCm39) missense probably damaging 1.00
R7644:Tex15 UTSW 8 34,064,445 (GRCm39) missense probably benign 0.01
R7724:Tex15 UTSW 8 34,036,291 (GRCm39) missense possibly damaging 0.60
R7779:Tex15 UTSW 8 34,065,309 (GRCm39) missense probably damaging 1.00
R7798:Tex15 UTSW 8 34,071,875 (GRCm39) missense possibly damaging 0.69
R7816:Tex15 UTSW 8 34,071,683 (GRCm39) missense probably benign 0.14
R7820:Tex15 UTSW 8 34,065,090 (GRCm39) missense probably damaging 0.98
R8041:Tex15 UTSW 8 34,065,874 (GRCm39) missense probably damaging 1.00
R8150:Tex15 UTSW 8 34,063,534 (GRCm39) missense probably benign 0.06
R8152:Tex15 UTSW 8 34,062,921 (GRCm39) missense possibly damaging 0.82
R8237:Tex15 UTSW 8 34,067,427 (GRCm39) missense possibly damaging 0.72
R8250:Tex15 UTSW 8 34,055,233 (GRCm39) missense probably null 0.27
R8264:Tex15 UTSW 8 34,072,390 (GRCm39) missense probably benign 0.18
R8279:Tex15 UTSW 8 34,061,765 (GRCm39) missense probably damaging 0.96
R8353:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8388:Tex15 UTSW 8 34,065,237 (GRCm39) missense probably benign 0.00
R8432:Tex15 UTSW 8 34,066,572 (GRCm39) missense probably damaging 0.99
R8453:Tex15 UTSW 8 34,066,899 (GRCm39) nonsense probably null
R8489:Tex15 UTSW 8 34,067,574 (GRCm39) missense probably benign 0.02
R8670:Tex15 UTSW 8 34,064,746 (GRCm39) missense probably benign 0.19
R8703:Tex15 UTSW 8 34,062,724 (GRCm39) missense probably benign 0.00
R8871:Tex15 UTSW 8 34,066,992 (GRCm39) missense possibly damaging 0.62
R8945:Tex15 UTSW 8 34,064,724 (GRCm39) missense probably benign 0.00
R9104:Tex15 UTSW 8 34,060,950 (GRCm39) missense possibly damaging 0.86
R9132:Tex15 UTSW 8 34,067,554 (GRCm39) missense possibly damaging 0.84
R9207:Tex15 UTSW 8 34,065,784 (GRCm39) missense probably damaging 1.00
R9210:Tex15 UTSW 8 34,064,319 (GRCm39) missense possibly damaging 0.91
R9330:Tex15 UTSW 8 34,065,143 (GRCm39) missense probably benign 0.01
R9354:Tex15 UTSW 8 34,063,344 (GRCm39) missense possibly damaging 0.86
R9365:Tex15 UTSW 8 34,064,564 (GRCm39) missense possibly damaging 0.56
R9440:Tex15 UTSW 8 34,072,273 (GRCm39) missense possibly damaging 0.90
R9534:Tex15 UTSW 8 34,060,999 (GRCm39) missense probably benign 0.45
R9570:Tex15 UTSW 8 34,067,309 (GRCm39) missense probably damaging 0.96
R9574:Tex15 UTSW 8 34,064,509 (GRCm39) missense probably benign 0.09
R9618:Tex15 UTSW 8 34,062,397 (GRCm39) missense probably benign 0.35
R9655:Tex15 UTSW 8 34,066,784 (GRCm39) nonsense probably null
R9786:Tex15 UTSW 8 34,062,457 (GRCm39) missense probably damaging 1.00
R9798:Tex15 UTSW 8 34,062,721 (GRCm39) missense probably damaging 0.98
RF005:Tex15 UTSW 8 34,066,705 (GRCm39) missense probably benign 0.05
X0020:Tex15 UTSW 8 34,066,607 (GRCm39) missense probably benign 0.03
X0065:Tex15 UTSW 8 34,065,545 (GRCm39) nonsense probably null
Z1088:Tex15 UTSW 8 34,061,343 (GRCm39) missense possibly damaging 0.89
Z1088:Tex15 UTSW 8 34,064,898 (GRCm39) missense probably benign
Z1088:Tex15 UTSW 8 34,061,838 (GRCm39) missense possibly damaging 0.68
Z1176:Tex15 UTSW 8 34,064,754 (GRCm39) missense possibly damaging 0.84
Predicted Primers PCR Primer
(F):5'- TTCAGTGCAAGAATCAGGAGATGTG -3'
(R):5'- CTAATGTGCTTCTCTGACTGCG -3'

Sequencing Primer
(F):5'- GAGCAAGTCTGAGAGTTCCCATTC -3'
(R):5'- GCTTCTCTGACTGCGAAAATG -3'
Posted On 2017-10-10