Mutagenetix > Incidental Mutation

Incidental Mutation 'R6126:Mef2b'

487401

Institutional Source

Beutler Lab

Gene Symbol

Mef2b

Ensembl Gene

ENSMUSG00000079033

Gene Name

myocyte enhancer factor 2B

Synonyms

MMRRC Submission

044273-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

70139711-70167488 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 70166876 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 267 (T267K)

Ref Sequence

ENSEMBL: ENSMUSP00000132314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]

AlphaFold

no structure available at present

Predicted Effect

silent
Transcript: ENSMUST00000110140

SMART Domains

Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC

Predicted Effect

silent
Transcript: ENSMUST00000110141

SMART Domains

Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110143
AA Change: T257K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)

SMART Domains

Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: T257K

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
low complexity region	310	325	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000110146
AA Change: T267K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: T267K

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
low complexity region	320	335	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163756
AA Change: T267K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: T267K

Domain	Start	End	E-Value	Type
MADS	1	60	3.15e-34	SMART
low complexity region	97	114	N/A	INTRINSIC
low complexity region	285	297	N/A	INTRINSIC
low complexity region	320	335	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Mef2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
PIT4378001:Mef2b	UTSW	8	70164260	missense	probably damaging	1.00
R1023:Mef2b	UTSW	8	70165597	missense	possibly damaging	0.82
R4091:Mef2b	UTSW	8	70165102	missense	probably damaging	1.00
R4162:Mef2b	UTSW	8	70166311	missense	probably damaging	1.00
R4562:Mef2b	UTSW	8	70167268	missense	probably damaging	1.00
R4950:Mef2b	UTSW	8	70167196	missense	probably damaging	1.00
R5318:Mef2b	UTSW	8	70166843	missense	probably damaging	0.99
R5752:Mef2b	UTSW	8	70165617	missense	possibly damaging	0.77
R6279:Mef2b	UTSW	8	70167119	missense	possibly damaging	0.78
R6300:Mef2b	UTSW	8	70167119	missense	possibly damaging	0.78
R6332:Mef2b	UTSW	8	70164139	splice site	probably null
R6369:Mef2b	UTSW	8	70165559	missense	probably benign	0.05
R6873:Mef2b	UTSW	8	70166307	missense	probably benign	0.29
R7266:Mef2b	UTSW	8	70164288	missense	probably damaging	1.00
R9638:Mef2b	UTSW	8	70166856	frame shift	probably null
X0022:Mef2b	UTSW	8	70166834	missense	probably benign	0.41
Z1176:Mef2b	UTSW	8	70166375	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGCCCTGTCTGATTTGCCTG -3'
(R):5'- TCGCTCAGACTTGATGCTG -3'

Sequencing Primer
(F):5'- TCTGATTTGCCTGACCGTTG -3'
(R):5'- TCAGACTTGATGCTGACCGGAG -3'

Posted On

2017-10-10