Incidental Mutation 'R6126:Mef2b'
ID 487401
Institutional Source Beutler Lab
Gene Symbol Mef2b
Ensembl Gene ENSMUSG00000079033
Gene Name myocyte enhancer factor 2B
Synonyms
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 70139711-70167488 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 70166876 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Lysine at position 267 (T267K)
Ref Sequence ENSEMBL: ENSMUSP00000132314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110140] [ENSMUST00000110141] [ENSMUST00000110143] [ENSMUST00000110146] [ENSMUST00000163756]
AlphaFold no structure available at present
Predicted Effect silent
Transcript: ENSMUST00000110140
SMART Domains Protein: ENSMUSP00000105767
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect silent
Transcript: ENSMUST00000110141
SMART Domains Protein: ENSMUSP00000105768
Gene: ENSMUSG00000079033

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110143
AA Change: T257K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000105770
Gene: ENSMUSG00000079033
AA Change: T257K

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 275 287 N/A INTRINSIC
low complexity region 310 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110146
AA Change: T267K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000105773
Gene: ENSMUSG00000079033
AA Change: T267K

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163756
AA Change: T267K

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000132314
Gene: ENSMUSG00000079033
AA Change: T267K

DomainStartEndE-ValueType
MADS 1 60 3.15e-34 SMART
low complexity region 97 114 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
low complexity region 320 335 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene is a member of the MADS/MEF2 family of DNA binding proteins. The protein is thought to regulate gene expression, including expression of the smooth muscle myosin heavy chain gene. This region undergoes considerable alternative splicing, with transcripts supporting two non-overlapping loci (GeneID 729991 and 100271849) as well as numerous read-through transcripts that span both loci (annotated as GeneID 4207). Several isoforms of this protein are expressed from either this locus or from some of the read-through transcripts annotated on GeneID 4207. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Mef2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
PIT4378001:Mef2b UTSW 8 70164260 missense probably damaging 1.00
R1023:Mef2b UTSW 8 70165597 missense possibly damaging 0.82
R4091:Mef2b UTSW 8 70165102 missense probably damaging 1.00
R4162:Mef2b UTSW 8 70166311 missense probably damaging 1.00
R4562:Mef2b UTSW 8 70167268 missense probably damaging 1.00
R4950:Mef2b UTSW 8 70167196 missense probably damaging 1.00
R5318:Mef2b UTSW 8 70166843 missense probably damaging 0.99
R5752:Mef2b UTSW 8 70165617 missense possibly damaging 0.77
R6279:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6300:Mef2b UTSW 8 70167119 missense possibly damaging 0.78
R6332:Mef2b UTSW 8 70164139 splice site probably null
R6369:Mef2b UTSW 8 70165559 missense probably benign 0.05
R6873:Mef2b UTSW 8 70166307 missense probably benign 0.29
R7266:Mef2b UTSW 8 70164288 missense probably damaging 1.00
X0022:Mef2b UTSW 8 70166834 missense probably benign 0.41
Z1176:Mef2b UTSW 8 70166375 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCCCTGTCTGATTTGCCTG -3'
(R):5'- TCGCTCAGACTTGATGCTG -3'

Sequencing Primer
(F):5'- TCTGATTTGCCTGACCGTTG -3'
(R):5'- TCAGACTTGATGCTGACCGGAG -3'
Posted On 2017-10-10