Incidental Mutation 'R6126:Ntpcr'
ID487402
Institutional Source Beutler Lab
Gene Symbol Ntpcr
Ensembl Gene ENSMUSG00000031851
Gene Namenucleoside-triphosphatase, cancer-related
Synonyms
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location125729963-125748235 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 125735887 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034313] [ENSMUST00000065135] [ENSMUST00000143504] [ENSMUST00000152189]
Predicted Effect probably benign
Transcript: ENSMUST00000034313
SMART Domains Protein: ENSMUSP00000034313
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
AAA 1 170 2.61e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000065135
SMART Domains Protein: ENSMUSP00000069384
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 4 107 1.4e-40 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123554
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138656
Predicted Effect probably benign
Transcript: ENSMUST00000143504
SMART Domains Protein: ENSMUSP00000121271
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 56 145 5.4e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146055
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151172
Predicted Effect probably null
Transcript: ENSMUST00000152189
SMART Domains Protein: ENSMUSP00000115996
Gene: ENSMUSG00000031851

DomainStartEndE-ValueType
Pfam:NTPase_1 6 178 3.2e-63 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a non-specific nucleoside triphosphatase that is slow-acting in vitro. This gene is overexpressed in many tumor tissues, and while it is not essential for the cell, overexpression is cytotoxic. However, the cytotoxicity is not related to its triphosphatase activity. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Ntpcr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00971:Ntpcr APN 8 125747762 missense probably damaging 0.98
IGL01582:Ntpcr APN 8 125745242 missense probably benign 0.11
IGL01862:Ntpcr APN 8 125736098 missense probably benign 0.14
IGL02045:Ntpcr APN 8 125745452 splice site probably benign
IGL02077:Ntpcr APN 8 125737368 nonsense probably null
R0491:Ntpcr UTSW 8 125737354 nonsense probably null
R0988:Ntpcr UTSW 8 125737431 splice site probably benign
R1781:Ntpcr UTSW 8 125745402 missense probably damaging 1.00
R2412:Ntpcr UTSW 8 125745405 missense probably damaging 1.00
R3838:Ntpcr UTSW 8 125737372 missense probably damaging 1.00
R4453:Ntpcr UTSW 8 125736190 missense probably benign 0.14
R6440:Ntpcr UTSW 8 125745242 missense probably damaging 0.97
R6463:Ntpcr UTSW 8 125736104 missense probably benign 0.02
R7102:Ntpcr UTSW 8 125730055 missense unknown
R7910:Ntpcr UTSW 8 125747744 missense probably benign
R8230:Ntpcr UTSW 8 125737420 critical splice donor site probably null
X0024:Ntpcr UTSW 8 125745426 missense probably damaging 0.99
X0025:Ntpcr UTSW 8 125745315 missense probably damaging 1.00
Z1177:Ntpcr UTSW 8 125745284 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGGATTATGCTGCAACCCTC -3'
(R):5'- TTGCCAACCCCTGAAAGAG -3'

Sequencing Primer
(F):5'- ATGCTGCAACCCTCTGGCC -3'
(R):5'- ACCCCTGAAAGAGACAAAGG -3'
Posted On2017-10-10