Mutagenetix > Incidental Mutation

Incidental Mutation 'R6126:Hsf2'

487405

Institutional Source

Beutler Lab

Gene Symbol

Hsf2

Ensembl Gene

ENSMUSG00000019878

Gene Name

heat shock factor 2

Synonyms

MMRRC Submission

044273-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57486385-57513135 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 57495917 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 38 (V38A)

Ref Sequence

ENSEMBL: ENSMUSP00000151957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079833] [ENSMUST00000220042] [ENSMUST00000220353]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000079833
AA Change: V38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000078761
Gene: ENSMUSG00000019878
AA Change: V38A

Domain	Start	End	E-Value	Type
HSF	6	110	1.99e-62	SMART
coiled coil region	133	176	N/A	INTRINSIC
Pfam:Vert_HS_TF	230	392	1.5e-39	PFAM
Pfam:Vert_HS_TF	391	494	2.2e-18	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000218251

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219171

Predicted Effect

probably benign
Transcript: ENSMUST00000220042

Predicted Effect

probably damaging
Transcript: ENSMUST00000220353
AA Change: V38A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.9084

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the HSF family of transcription factors that bind specifically to the heat-shock promoter element and activate transcription. Heat shock transcription factors activate heat-shock response genes under conditions of heat or other stresses. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased late-gestational lethality associated with collapsed lateral ventricles and ventricular bleeding. Survivors may show ventricular dilation, sterility in females, and reduced sperm counts in males. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Hsf2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00516:Hsf2	APN	10	57512028	missense	probably benign	0.00
IGL00965:Hsf2	APN	10	57512100	missense	probably damaging	1.00
IGL01338:Hsf2	APN	10	57501379	missense	probably damaging	1.00
IGL01518:Hsf2	APN	10	57512134	missense	probably damaging	1.00
IGL01721:Hsf2	APN	10	57496181	missense	probably benign	0.13
IGL02219:Hsf2	APN	10	57496274	missense	probably damaging	1.00
IGL03493:Hsf2	APN	10	57505366	missense	probably damaging	1.00
G1Funyon:Hsf2	UTSW	10	57505346	missense	probably damaging	1.00
R0270:Hsf2	UTSW	10	57502639	missense	probably benign	0.28
R1774:Hsf2	UTSW	10	57512146	missense	probably damaging	1.00
R2406:Hsf2	UTSW	10	57497546	missense	probably damaging	0.96
R3410:Hsf2	UTSW	10	57505282	missense	probably damaging	1.00
R4829:Hsf2	UTSW	10	57496170	missense	probably damaging	0.96
R4958:Hsf2	UTSW	10	57501371	missense	probably damaging	0.99
R5154:Hsf2	UTSW	10	57504712	missense	probably benign
R5237:Hsf2	UTSW	10	57506221	missense	probably benign	0.16
R5903:Hsf2	UTSW	10	57504723	missense	probably benign
R6125:Hsf2	UTSW	10	57512005	missense	probably benign
R6280:Hsf2	UTSW	10	57511495	missense	probably benign	0.03
R6309:Hsf2	UTSW	10	57486580	start gained	probably benign
R6954:Hsf2	UTSW	10	57504643	missense	probably damaging	1.00
R6966:Hsf2	UTSW	10	57495984	missense	probably damaging	1.00
R7088:Hsf2	UTSW	10	57512092	missense	probably damaging	1.00
R7182:Hsf2	UTSW	10	57505176	missense	possibly damaging	0.87
R7511:Hsf2	UTSW	10	57504557	missense	probably benign	0.00
R7743:Hsf2	UTSW	10	57511335	splice site	probably null
R8176:Hsf2	UTSW	10	57505194	nonsense	probably null
R8301:Hsf2	UTSW	10	57505346	missense	probably damaging	1.00
R8368:Hsf2	UTSW	10	57512145	missense	probably damaging	1.00
R8682:Hsf2	UTSW	10	57505171	missense	possibly damaging	0.94
R9506:Hsf2	UTSW	10	57505145	critical splice acceptor site	probably null
R9520:Hsf2	UTSW	10	57495900	missense	probably damaging	0.99
Z1088:Hsf2	UTSW	10	57496168	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACGGAACATGGTGAAGCTTTTG -3'
(R):5'- TCGGAAGCCATCTGACAAAG -3'

Sequencing Primer
(F):5'- GCTGACATTGGAAAACATTCTTG -3'
(R):5'- TTTACATGACTAACATCAGACAAGTC -3'

Posted On

2017-10-10