Incidental Mutation 'R6126:Otx1'
ID487408
Institutional Source Beutler Lab
Gene Symbol Otx1
Ensembl Gene ENSMUSG00000005917
Gene Nameorthodenticle homeobox 1
SynonymsA730044F23Rik, jv
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location21994764-22002897 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to C at 21996457 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000134704 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006071] [ENSMUST00000147486]
Predicted Effect unknown
Transcript: ENSMUST00000006071
AA Change: H284R
SMART Domains Protein: ENSMUSP00000006071
Gene: ENSMUSG00000005917
AA Change: H284R

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
Pfam:TF_Otx 178 279 2.5e-39 PFAM
internal_repeat_1 310 322 1.39e-7 PROSPERO
low complexity region 324 331 N/A INTRINSIC
internal_repeat_1 334 346 1.39e-7 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000147486
SMART Domains Protein: ENSMUSP00000134704
Gene: ENSMUSG00000005917

DomainStartEndE-ValueType
HOX 38 100 1.21e-25 SMART
low complexity region 117 125 N/A INTRINSIC
low complexity region 133 147 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172395
Meta Mutation Damage Score 0.0830 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: This gene encodes a member of the bicoid subfamily of the paired homeobox transcription factor family. The encoded protein is critical to the maintenance and regionalization of the forebrain and midbrain during development. It may also have important functions in sense organ development, pituitary function, and in the regulation of blood cell production. [provided by RefSeq, Jul 2008]
PHENOTYPE: Inner ear abnormalities and circling/head-shaking behavior are seen in mild mutants; null mutants also have spontaneous seizures and defects in dorsal telencephalic cortex, mesencephalon, cerebellum and eye; and show delayed growth and sexual maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Otx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00574:Otx1 APN 11 21996794 unclassified probably benign
Embarrassed UTSW 11 21997037 missense probably damaging 1.00
R1946:Otx1 UTSW 11 21998482 missense probably damaging 1.00
R2291:Otx1 UTSW 11 21996634 unclassified probably benign
R2870:Otx1 UTSW 11 21998681 intron probably benign
R4164:Otx1 UTSW 11 21996638 unclassified probably benign
R4845:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4925:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4934:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R4993:Otx1 UTSW 11 21998532 splice site probably null
R5061:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5062:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5063:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5068:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5069:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5070:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5097:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5169:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5170:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5171:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5172:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5198:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5199:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5200:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5201:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5202:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5203:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5204:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5205:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5256:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5267:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5360:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5361:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5363:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5372:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5375:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5380:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5381:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5382:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5383:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5415:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5416:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5534:Otx1 UTSW 11 21996296 unclassified probably benign
R5592:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5594:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5725:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5727:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5735:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5736:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5841:Otx1 UTSW 11 21998594 intron probably benign
R5940:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R5941:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6080:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6081:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6093:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6131:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6132:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6134:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6187:Otx1 UTSW 11 21999406 missense probably damaging 1.00
R6220:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6269:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6270:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6271:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6272:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6396:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6619:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6624:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6680:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6681:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6718:Otx1 UTSW 11 21996412 unclassified probably benign
R6831:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6834:Otx1 UTSW 11 21997037 missense probably damaging 1.00
R6985:Otx1 UTSW 11 21996615 nonsense probably null
R7631:Otx1 UTSW 11 21999458 nonsense probably null
R8100:Otx1 UTSW 11 21999392 missense probably benign 0.16
X0054:Otx1 UTSW 11 21996331 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- ATAGGTAGTTGCGTTTCTTCTCCAC -3'
(R):5'- ACCCTATGTCCTATGGCCAG -3'

Sequencing Primer
(F):5'- TCCTTATAGTCCAGACAGTCGGGAG -3'
(R):5'- CTATGGCCAGGGCGGAAG -3'
Posted On2017-10-10