Mutagenetix > Incidental Mutations

Incidental Mutation 'R6126:Sez6'

487409

Institutional Source

Beutler Lab

Gene Symbol

Sez6

Ensembl Gene

ENSMUSG00000000632

Gene Name

seizure related gene 6

Synonyms

D11Bhm177e, sez-6

MMRRC Submission

044273-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

77930800-77979048 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 77973804 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Phenylalanine at position 530 (Y530F)

Ref Sequence

ENSEMBL: ENSMUSP00000091532 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000000646] [ENSMUST00000093995]

AlphaFold

Q7TSK2

Predicted Effect

probably damaging
Transcript: ENSMUST00000000646
AA Change: Y530F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000000646
Gene: ENSMUSG00000000632
AA Change: Y530F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	910	932	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000093995
AA Change: Y530F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091532
Gene: ENSMUSG00000000632
AA Change: Y530F

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
low complexity region	72	85	N/A	INTRINSIC
low complexity region	119	132	N/A	INTRINSIC
low complexity region	223	235	N/A	INTRINSIC
CUB	241	350	9.36e-2	SMART
CCP	354	409	1.23e-10	SMART
CUB	413	524	1.41e-28	SMART
CCP	529	586	5.43e-12	SMART
CUB	590	701	7.49e-24	SMART
CCP	707	762	3.09e-16	SMART
CCP	768	827	3.5e-15	SMART
CCP	835	892	1.42e-15	SMART
transmembrane domain	923	945	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126866

Predicted Effect

unknown
Transcript: ENSMUST00000140630
AA Change: Y157F

SMART Domains

Protein: ENSMUSP00000115660
Gene: ENSMUSG00000000632
AA Change: Y157F

Domain	Start	End	E-Value	Type
CUB	29	140	9.8e-28	SMART
CCP	157	214	5.43e-12	SMART
Pfam:CUB	218	278	1.6e-11	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142542

Predicted Effect

probably benign
Transcript: ENSMUST00000151982

SMART Domains

Protein: ENSMUSP00000132041
Gene: ENSMUSG00000000632

Domain	Start	End	E-Value	Type
low complexity region	57	69	N/A	INTRINSIC
CUB	75	184	9.36e-2	SMART
CCP	188	243	1.23e-10	SMART
CUB	247	358	8.08e-29	SMART
low complexity region	379	394	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155087

Meta Mutation Damage Score

0.0917

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to contain five cysteine-rich motifs that are similar to sushi domains, as well as two domains similar to the amino terminal half of the CUB (for complement C1r/C1s, Uegf, Bmp1) domain. Mutations in this gene have been associated with febrile seizures. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a null allele exhibit increased short dendrites, decreased excitatory synaptic signaling, resistance to pharmacologically induces seizures, decreased activity and impaired learning and coordination. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Sez6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01125:Sez6	APN	11	77977289	splice site	probably benign
IGL01142:Sez6	APN	11	77973816	missense	probably damaging	1.00
IGL02252:Sez6	APN	11	77974513	missense	probably damaging	1.00
IGL02332:Sez6	APN	11	77954742	splice site	probably benign
IGL02366:Sez6	APN	11	77976882	missense	probably damaging	0.98
IGL02479:Sez6	APN	11	77978026	missense	possibly damaging	0.84
IGL02963:Sez6	APN	11	77962949	missense	possibly damaging	0.93
velum	UTSW	11	77974549	missense	probably damaging	1.00
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0054:Sez6	UTSW	11	77953873	missense	possibly damaging	0.94
R0089:Sez6	UTSW	11	77974344	splice site	probably benign
R0485:Sez6	UTSW	11	77953813	missense	probably damaging	1.00
R0598:Sez6	UTSW	11	77977821	missense	possibly damaging	0.88
R0729:Sez6	UTSW	11	77976585	missense	probably benign	0.01
R1117:Sez6	UTSW	11	77974514	missense	probably damaging	1.00
R1199:Sez6	UTSW	11	77953885	missense	probably benign
R1534:Sez6	UTSW	11	77963045	missense	probably damaging	1.00
R1835:Sez6	UTSW	11	77953503	missense	probably benign
R1840:Sez6	UTSW	11	77953717	missense	possibly damaging	0.79
R1929:Sez6	UTSW	11	77972932	missense	probably damaging	1.00
R1970:Sez6	UTSW	11	77954068	critical splice donor site	probably null
R3156:Sez6	UTSW	11	77953779	missense	possibly damaging	0.63
R3930:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R3931:Sez6	UTSW	11	77976882	missense	probably damaging	0.98
R4894:Sez6	UTSW	11	77975260	missense	probably damaging	1.00
R4904:Sez6	UTSW	11	77975254	missense	probably damaging	1.00
R5026:Sez6	UTSW	11	77968989	missense	probably damaging	1.00
R5040:Sez6	UTSW	11	77969089	critical splice donor site	probably null
R5057:Sez6	UTSW	11	77973153	missense	probably damaging	1.00
R5093:Sez6	UTSW	11	77976562	missense	possibly damaging	0.88
R5640:Sez6	UTSW	11	77973759	intron	probably benign
R6013:Sez6	UTSW	11	77973797	missense	probably damaging	1.00
R6153:Sez6	UTSW	11	77977822	missense	probably damaging	0.99
R6279:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6300:Sez6	UTSW	11	77976541	missense	possibly damaging	0.63
R6475:Sez6	UTSW	11	77973844
R6722:Sez6	UTSW	11	77953702	missense	probably damaging	1.00
R6897:Sez6	UTSW	11	77953559	missense	probably damaging	1.00
R6910:Sez6	UTSW	11	77953869	missense	possibly damaging	0.85
R7012:Sez6	UTSW	11	77977795	missense	probably benign	0.04
R7233:Sez6	UTSW	11	77973137	missense	probably damaging	1.00
R7265:Sez6	UTSW	11	77962865	missense	probably damaging	0.96
R7289:Sez6	UTSW	11	77974323	missense	possibly damaging	0.96
R7405:Sez6	UTSW	11	77962891	missense	probably benign	0.10
R7408:Sez6	UTSW	11	77953530	missense	probably damaging	1.00
R7485:Sez6	UTSW	11	77973885	missense	probably benign	0.01
R7592:Sez6	UTSW	11	77978050	missense	probably damaging	0.99
R7778:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7793:Sez6	UTSW	11	77977600	missense	probably damaging	1.00
R7818:Sez6	UTSW	11	77976902	missense	probably damaging	1.00
R7824:Sez6	UTSW	11	77974549	missense	probably damaging	1.00
R7980:Sez6	UTSW	11	77953842	missense	probably benign	0.34
R8008:Sez6	UTSW	11	77973256	nonsense	probably null
R8840:Sez6	UTSW	11	77976487	missense	probably damaging	1.00
R8947:Sez6	UTSW	11	77953527	missense	probably damaging	1.00
R8973:Sez6	UTSW	11	77974571	missense	probably damaging	1.00
R9040:Sez6	UTSW	11	77973936	missense	probably benign
R9081:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9082:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9092:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9094:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9095:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9097:Sez6	UTSW	11	77974295	missense	possibly damaging	0.83
R9169:Sez6	UTSW	11	77977647	missense	probably damaging	0.96
X0013:Sez6	UTSW	11	77954780	missense	probably benign	0.01
X0067:Sez6	UTSW	11	77974438	critical splice acceptor site	probably null
Z1088:Sez6	UTSW	11	77973197	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GAGCACCTTTTGTATACTAAGCTCC -3'
(R):5'- AGGCTGGCTCTGTCTCATTC -3'

Sequencing Primer
(F):5'- CGGCTTCCTGACCAAAATAGAGTTG -3'
(R):5'- GTCTCATTCCACTGGGGGTC -3'

Posted On

2017-10-10