Incidental Mutation 'R6126:Apoh'
ID487411
Institutional Source Beutler Lab
Gene Symbol Apoh
Ensembl Gene ENSMUSG00000000049
Gene Nameapolipoprotein H
Synonymsbeta-2-GPI, beta-2-glycoprotein 1, B2GPI
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.470) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location108343354-108414396 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108397373 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 106 (I106F)
Ref Sequence ENSEMBL: ENSMUSP00000000049 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000049] [ENSMUST00000133383] [ENSMUST00000146050] [ENSMUST00000152958]
Predicted Effect probably damaging
Transcript: ENSMUST00000000049
AA Change: I106F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000000049
Gene: ENSMUSG00000000049
AA Change: I106F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
CCP 142 200 4.92e-10 SMART
CCP 205 260 1.98e-14 SMART
CCP 264 325 2.51e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133383
SMART Domains Protein: ENSMUSP00000115516
Gene: ENSMUSG00000000049

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:Sushi 23 51 6.7e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146050
Predicted Effect probably damaging
Transcript: ENSMUST00000152958
AA Change: I106F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114214
Gene: ENSMUSG00000000049
AA Change: I106F

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CCP 23 79 1.35e-7 SMART
CCP 84 137 2.53e-12 SMART
Meta Mutation Damage Score 0.1855 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Apolipoprotein H has been implicated in a variety of physiologic pathways including lipoprotein metabolism, coagulation, and the production of antiphospholipid autoantibodies. APOH may be a required cofactor for anionic phospholipid binding by the antiphospholipid autoantibodies found in sera of many patients with lupus and primary antiphospholipid syndrome, but it does not seem to be required for the reactivity of antiphospholipid autoantibodies associated with infections. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in reduced viability and reduced thrombin production. Only 8% homozygous null animals are born from heterozygous intercrosses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Apoh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Apoh APN 11 108395834 missense probably benign 0.45
IGL01327:Apoh APN 11 108397361 missense probably damaging 1.00
IGL01353:Apoh APN 11 108397385 missense probably damaging 1.00
IGL01464:Apoh APN 11 108395890 missense probably damaging 1.00
IGL02065:Apoh APN 11 108414305 utr 3 prime probably benign
IGL02646:Apoh APN 11 108412142 missense probably benign 0.15
R0125:Apoh UTSW 11 108412073 missense probably damaging 1.00
R0359:Apoh UTSW 11 108397373 missense probably damaging 1.00
R1969:Apoh UTSW 11 108407462 missense probably benign 0.00
R2280:Apoh UTSW 11 108409180 nonsense probably null
R2568:Apoh UTSW 11 108404871 missense probably benign 0.00
R4369:Apoh UTSW 11 108397379 missense probably damaging 1.00
R4789:Apoh UTSW 11 108409238 missense probably damaging 1.00
R4824:Apoh UTSW 11 108414261 missense probably benign 0.37
R4937:Apoh UTSW 11 108407378 missense probably benign 0.19
R5634:Apoh UTSW 11 108412049 missense probably damaging 1.00
R5900:Apoh UTSW 11 108412017 missense probably damaging 0.99
R5951:Apoh UTSW 11 108395903 missense probably damaging 1.00
R6054:Apoh UTSW 11 108395975 missense probably damaging 1.00
R7343:Apoh UTSW 11 108395848 missense probably benign 0.14
R7471:Apoh UTSW 11 108407305 missense probably damaging 1.00
X0065:Apoh UTSW 11 108395350 missense probably damaging 1.00
Z1176:Apoh UTSW 11 108343459 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TTAGATCGTCCAAGTCCTGTTG -3'
(R):5'- GCATTTGGTGAAAGCAGGAC -3'

Sequencing Primer
(F):5'- CGTCCAAGTCCTGTTGTAATACATG -3'
(R):5'- CATTTGGTGAAAGCAGGACTTAAATG -3'
Posted On2017-10-10