Incidental Mutation 'R6126:Wdr20'
ID487412
Institutional Source Beutler Lab
Gene Symbol Wdr20
Ensembl Gene ENSMUSG00000037957
Gene NameWD repeat domain 20
SynonymsWdr20a, 2310040A13Rik
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.915) question?
Stock #R6126 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location110737944-110804238 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110794102 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 474 (H474L)
Ref Sequence ENSEMBL: ENSMUSP00000093059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095410] [ENSMUST00000192870] [ENSMUST00000193053] [ENSMUST00000195886]
Predicted Effect probably benign
Transcript: ENSMUST00000095410
AA Change: H474L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093059
Gene: ENSMUSG00000037957
AA Change: H474L

DomainStartEndE-ValueType
WD40 140 178 2.66e0 SMART
WD40 209 248 4.95e-4 SMART
WD40 251 290 1.47e-6 SMART
WD40 293 382 8.59e-1 SMART
Blast:WD40 464 559 2e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000192870
SMART Domains Protein: ENSMUSP00000141887
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 1e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000193053
SMART Domains Protein: ENSMUSP00000141678
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 89 131 2e-16 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194118
Predicted Effect probably benign
Transcript: ENSMUST00000195886
SMART Domains Protein: ENSMUSP00000142157
Gene: ENSMUSG00000037957

DomainStartEndE-ValueType
Blast:WD40 29 71 1e-16 BLAST
Meta Mutation Damage Score 0.0583 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a WD repeat-containing protein that functions to preserve and regulate the activity of the USP12-UAF1 deubiquitinating enzyme complex. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2011]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Wdr20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00552:Wdr20 APN 12 110779449 nonsense probably null
IGL01663:Wdr20 APN 12 110793514 missense probably damaging 1.00
IGL02385:Wdr20 APN 12 110793223 missense probably benign
IGL02710:Wdr20 APN 12 110793110 splice site probably benign
IGL02993:Wdr20 APN 12 110794308 nonsense probably null
R1500:Wdr20 UTSW 12 110794030 missense probably benign
R1897:Wdr20 UTSW 12 110793723 missense probably benign
R2006:Wdr20 UTSW 12 110793568 missense probably damaging 1.00
R3615:Wdr20 UTSW 12 110793939 missense probably benign
R3616:Wdr20 UTSW 12 110793939 missense probably benign
R4023:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4026:Wdr20 UTSW 12 110793516 missense probably benign 0.01
R4157:Wdr20 UTSW 12 110738174 missense possibly damaging 0.68
R4868:Wdr20 UTSW 12 110738234 missense probably damaging 1.00
R6282:Wdr20 UTSW 12 110797009 unclassified probably benign
R6867:Wdr20 UTSW 12 110793699 missense probably benign
R7081:Wdr20 UTSW 12 110803450 missense possibly damaging 0.46
R7842:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R7925:Wdr20 UTSW 12 110738215 missense probably benign 0.01
R8045:Wdr20 UTSW 12 110793319 missense not run
Predicted Primers PCR Primer
(F):5'- GTCACTACACCTGGGAACTC -3'
(R):5'- CTGACAAGCAGTGACTATACAGTC -3'

Sequencing Primer
(F):5'- ACTACACCTGGGAACTCTGTGC -3'
(R):5'- ACCAATACCGTCAGTCTTTCATGAG -3'
Posted On2017-10-10