Mutagenetix > Incidental Mutation

Incidental Mutation 'R6126:Il31ra'

487415

Institutional Source

Beutler Lab

Gene Symbol

Il31ra

Ensembl Gene

ENSMUSG00000050377

Gene Name

interleukin 31 receptor A

Synonyms

GLM-R, GPL

MMRRC Submission

044273-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112519898-112594360 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 112530374 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Arginine at position 390 (L390R)

Ref Sequence

ENSEMBL: ENSMUSP00000153382 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051756] [ENSMUST00000223752] [ENSMUST00000223819] [ENSMUST00000224510] [ENSMUST00000224576]

AlphaFold

Q8K5B1

Predicted Effect

probably damaging
Transcript: ENSMUST00000051756
AA Change: L471R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058045
Gene: ENSMUSG00000050377
AA Change: L471R

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
FN3	115	198	7.75e0	SMART
Blast:FN3	216	297	1e-40	BLAST
FN3	325	394	1.15e1	SMART
FN3	408	490	7.18e-3	SMART
low complexity region	508	522	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223577

Predicted Effect

probably benign
Transcript: ENSMUST00000223752

Predicted Effect

probably damaging
Transcript: ENSMUST00000223819
AA Change: L498R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224070

Predicted Effect

probably damaging
Transcript: ENSMUST00000224510
AA Change: L390R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000224576

Meta Mutation Damage Score

0.4651

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the type I cytokine receptor family. This receptor, with homology to gp130, is expressed on monocytes, and is involved in IL-31 signaling via activation of STAT-3 and STAT-5. It functions either as a monomer, or as part of a receptor complex with oncostatin M receptor (OSMR). Several alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
PHENOTYPE: Homozygous null mice display no apparent abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Smchd1	A	T	17: 71,370,285	V1503D	probably damaging	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Il31ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Il31ra	APN	13	112547478	missense	possibly damaging	0.94
IGL00639:Il31ra	APN	13	112549559	nonsense	probably null
IGL01640:Il31ra	APN	13	112531758	missense	possibly damaging	0.58
IGL02009:Il31ra	APN	13	112533867	missense	probably damaging	0.98
IGL02431:Il31ra	APN	13	112530296	missense	probably damaging	1.00
IGL02675:Il31ra	APN	13	112524352	missense	probably benign	0.00
IGL02718:Il31ra	APN	13	112530369	nonsense	probably null
IGL03388:Il31ra	APN	13	112546212	missense	probably damaging	1.00
IGL03408:Il31ra	APN	13	112525888	missense	probably benign	0.21
R0482:Il31ra	UTSW	13	112527481	missense	possibly damaging	0.89
R0639:Il31ra	UTSW	13	112525843	missense	possibly damaging	0.95
R0905:Il31ra	UTSW	13	112531673	missense	probably damaging	1.00
R0948:Il31ra	UTSW	13	112530378	missense	possibly damaging	0.81
R1420:Il31ra	UTSW	13	112531752	missense	probably damaging	1.00
R1538:Il31ra	UTSW	13	112547466	missense	possibly damaging	0.91
R1776:Il31ra	UTSW	13	112541239	missense	probably damaging	0.97
R1931:Il31ra	UTSW	13	112541222	missense	probably damaging	1.00
R2006:Il31ra	UTSW	13	112530356	missense	probably damaging	1.00
R2134:Il31ra	UTSW	13	112543888	missense	possibly damaging	0.94
R3103:Il31ra	UTSW	13	112530351	missense	probably damaging	1.00
R4089:Il31ra	UTSW	13	112551919	nonsense	probably null
R4742:Il31ra	UTSW	13	112523967	nonsense	probably null
R4787:Il31ra	UTSW	13	112527545	missense	possibly damaging	0.82
R5154:Il31ra	UTSW	13	112523997	missense	possibly damaging	0.87
R5193:Il31ra	UTSW	13	112524330	missense	probably benign	0.34
R5402:Il31ra	UTSW	13	112524135	missense	probably benign	0.01
R5743:Il31ra	UTSW	13	112527487	missense	possibly damaging	0.89
R5917:Il31ra	UTSW	13	112546312	missense	probably benign
R6414:Il31ra	UTSW	13	112523907	missense	possibly damaging	0.90
R6580:Il31ra	UTSW	13	112551942	missense	possibly damaging	0.90
R6727:Il31ra	UTSW	13	112547368	missense	probably damaging	1.00
R6783:Il31ra	UTSW	13	112551988	critical splice acceptor site	probably null
R6912:Il31ra	UTSW	13	112549464	missense	probably damaging	0.99
R6925:Il31ra	UTSW	13	112527529	missense	possibly damaging	0.56
R7187:Il31ra	UTSW	13	112546311	missense	probably benign	0.04
R7210:Il31ra	UTSW	13	112549500	missense	possibly damaging	0.95
R7236:Il31ra	UTSW	13	112523905	makesense	probably null
R7323:Il31ra	UTSW	13	112551963	missense	probably damaging	1.00
R7618:Il31ra	UTSW	13	112551980	missense	possibly damaging	0.66
R7783:Il31ra	UTSW	13	112541251	missense	probably benign
R8353:Il31ra	UTSW	13	112524183	missense	probably damaging	1.00
R8453:Il31ra	UTSW	13	112524183	missense	probably damaging	1.00
R8679:Il31ra	UTSW	13	112525838	missense	possibly damaging	0.81
R8890:Il31ra	UTSW	13	112524327	missense	possibly damaging	0.95
R9032:Il31ra	UTSW	13	112524094	missense
R9077:Il31ra	UTSW	13	112533827	missense	probably benign	0.00
R9085:Il31ra	UTSW	13	112524094	missense
R9147:Il31ra	UTSW	13	112533742	missense	probably benign	0.01
R9148:Il31ra	UTSW	13	112533742	missense	probably benign	0.01
R9158:Il31ra	UTSW	13	112533860	nonsense	probably null
R9178:Il31ra	UTSW	13	112541246	missense	probably damaging	1.00
R9250:Il31ra	UTSW	13	112532974	missense	probably damaging	1.00
R9260:Il31ra	UTSW	13	112531668	missense	probably damaging	0.98
R9312:Il31ra	UTSW	13	112549489	missense	probably benign	0.01
R9381:Il31ra	UTSW	13	112531719	missense	possibly damaging	0.81

Predicted Primers

PCR Primer
(F):5'- TAACTCCTGGGAGGTGAGTGAG -3'
(R):5'- GTTAACCTTACAGCCTGAGTTTTC -3'

Sequencing Primer
(F):5'- AGAAGCCATGCTCTGCTG -3'
(R):5'- ATCAAGCACTCGTCTGTTGTAG -3'

Posted On

2017-10-10