Incidental Mutation 'R6126:Phf20l1'
ID 487418
Institutional Source Beutler Lab
Gene Symbol Phf20l1
Ensembl Gene ENSMUSG00000072501
Gene Name PHD finger protein 20-like 1
Synonyms CGI-72, E130113K22Rik
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.250) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 66577560-66647976 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 66636824 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Histidine to Arginine at position 844 (H844R)
Ref Sequence ENSEMBL: ENSMUSP00000035682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048188] [ENSMUST00000229160] [ENSMUST00000229576] [ENSMUST00000230948]
AlphaFold Q8CCJ9
Predicted Effect probably benign
Transcript: ENSMUST00000048188
AA Change: H844R

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000035682
Gene: ENSMUSG00000072501
AA Change: H844R

DomainStartEndE-ValueType
TUDOR 11 71 7.67e0 SMART
Agenet 11 73 3.53e0 SMART
Agenet 85 141 4.54e-1 SMART
TUDOR 85 141 5.75e-8 SMART
Pfam:DUF3776 210 319 1.3e-31 PFAM
Pfam:PHD20L1_u1 318 413 4.7e-47 PFAM
low complexity region 443 453 N/A INTRINSIC
low complexity region 530 543 N/A INTRINSIC
low complexity region 547 585 N/A INTRINSIC
low complexity region 598 608 N/A INTRINSIC
low complexity region 642 658 N/A INTRINSIC
PHD 683 727 8.45e-3 SMART
low complexity region 879 887 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229033
Predicted Effect probably benign
Transcript: ENSMUST00000229160
AA Change: H843R

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)
Predicted Effect probably benign
Transcript: ENSMUST00000229576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230250
Predicted Effect probably benign
Transcript: ENSMUST00000230948
AA Change: H817R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231177
Meta Mutation Damage Score 0.0594 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 (GRCm38) R111H probably damaging Het
Alk G A 17: 71,875,042 (GRCm38) L1329F possibly damaging Het
Apoh A T 11: 108,397,373 (GRCm38) I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 (GRCm38) M126I probably benign Het
Cactin G A 10: 81,324,309 (GRCm38) R412H possibly damaging Het
Chd7 T C 4: 8,826,482 (GRCm38) S949P probably damaging Het
Clec11a C T 7: 44,304,921 (GRCm38) A203T probably damaging Het
Dnase1l1 C T X: 74,277,038 (GRCm38) probably null Het
Dst T A 1: 34,228,183 (GRCm38) I5080K probably damaging Het
Ecd T C 14: 20,338,425 (GRCm38) probably null Het
Eml2 G A 7: 19,201,163 (GRCm38) V432I probably damaging Het
Fan1 T A 7: 64,364,570 (GRCm38) K638* probably null Het
Fblim1 G A 4: 141,584,722 (GRCm38) R231C probably damaging Het
Fig4 A G 10: 41,265,447 (GRCm38) I272T probably damaging Het
Foxd2 C A 4: 114,908,505 (GRCm38) G106V unknown Het
Ggcx A T 6: 72,417,983 (GRCm38) M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 (GRCm38) R72H unknown Het
Hsf2 T C 10: 57,495,917 (GRCm38) V38A probably damaging Het
Ifi208 A G 1: 173,677,708 (GRCm38) Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 (GRCm38) L390R probably damaging Het
Kif1a A T 1: 93,019,899 (GRCm38) Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 (GRCm38) T267K probably benign Het
Mfsd8 A G 3: 40,832,011 (GRCm38) probably null Het
Mnx1 G T 5: 29,478,112 (GRCm38) A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 (GRCm38) I949F possibly damaging Het
Muc6 G T 7: 141,638,772 (GRCm38) T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 (GRCm38) probably null Het
Or12j3 T G 7: 140,373,253 (GRCm38) Y119S probably damaging Het
Otx1 T C 11: 21,996,457 (GRCm38) probably benign Het
Panx1 T A 9: 15,007,790 (GRCm38) I258F probably benign Het
Pask T C 1: 93,314,359 (GRCm38) Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 (GRCm38) K265R probably benign Het
Ppp6r1 T C 7: 4,643,377 (GRCm38) T136A possibly damaging Het
Rab35 A G 5: 115,645,708 (GRCm38) N185D probably benign Het
Rdh1 A T 10: 127,763,214 (GRCm38) D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 (GRCm38) D1188V probably benign Het
Robo2 C T 16: 73,920,682 (GRCm38) G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 (GRCm38) probably benign Het
Ryr1 A C 7: 29,076,239 (GRCm38) D2282E probably null Het
Ryr3 A G 2: 112,757,670 (GRCm38) L2642P probably damaging Het
Sez6 A T 11: 77,973,804 (GRCm38) Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 (GRCm38) Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 (GRCm38) H49L probably benign Het
Smchd1 A T 17: 71,370,285 (GRCm38) V1503D probably damaging Het
Spata31e3 G T 13: 50,246,290 (GRCm38) Q667K probably benign Het
Srsf11 C T 3: 158,023,344 (GRCm38) probably benign Het
Tex15 A G 8: 33,573,563 (GRCm38) N1007S probably benign Het
Tpk1 A T 6: 43,423,660 (GRCm38) C143S probably damaging Het
Wdr20 A T 12: 110,794,102 (GRCm38) H474L probably benign Het
Wnk4 A G 11: 101,276,348 (GRCm38) probably benign Het
Zfp292 T C 4: 34,808,497 (GRCm38) T1516A probably benign Het
Zfp462 G A 4: 55,023,573 (GRCm38) A2121T probably benign Het
Zfp647 G A 15: 76,912,085 (GRCm38) P125L probably damaging Het
Other mutations in Phf20l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Phf20l1 APN 15 66,629,035 (GRCm38) missense probably benign 0.28
IGL00484:Phf20l1 APN 15 66,615,633 (GRCm38) splice site probably benign
IGL00668:Phf20l1 APN 15 66,632,849 (GRCm38) missense probably damaging 0.99
IGL00849:Phf20l1 APN 15 66,636,832 (GRCm38) missense probably benign 0.00
IGL00954:Phf20l1 APN 15 66,641,908 (GRCm38) missense probably damaging 1.00
IGL01025:Phf20l1 APN 15 66,613,132 (GRCm38) missense probably damaging 1.00
IGL01504:Phf20l1 APN 15 66,597,691 (GRCm38) missense possibly damaging 0.73
IGL02087:Phf20l1 APN 15 66,628,991 (GRCm38) missense probably damaging 1.00
IGL02273:Phf20l1 APN 15 66,640,025 (GRCm38) missense probably damaging 1.00
IGL02276:Phf20l1 APN 15 66,615,410 (GRCm38) critical splice donor site probably null
IGL02372:Phf20l1 APN 15 66,641,801 (GRCm38) missense probably damaging 1.00
IGL02589:Phf20l1 APN 15 66,615,632 (GRCm38) splice site probably benign
IGL02656:Phf20l1 APN 15 66,629,827 (GRCm38) missense probably damaging 1.00
IGL02691:Phf20l1 APN 15 66,604,864 (GRCm38) missense probably damaging 1.00
IGL02881:Phf20l1 APN 15 66,594,980 (GRCm38) critical splice donor site probably null
IGL02940:Phf20l1 APN 15 66,595,151 (GRCm38) missense probably damaging 1.00
IGL02943:Phf20l1 APN 15 66,594,884 (GRCm38) missense probably damaging 1.00
IGL03030:Phf20l1 APN 15 66,641,947 (GRCm38) utr 3 prime probably benign
IGL03034:Phf20l1 APN 15 66,597,403 (GRCm38) missense probably damaging 1.00
Abbreviated UTSW 15 66,632,903 (GRCm38) critical splice donor site probably null
acadia UTSW 15 66,636,820 (GRCm38) missense possibly damaging 0.85
curt UTSW 15 66,639,948 (GRCm38) missense possibly damaging 0.90
Cut UTSW 15 66,613,039 (GRCm38) nonsense probably null
shorthand UTSW 15 66,609,547 (GRCm38) missense probably damaging 1.00
slang UTSW 15 66,641,932 (GRCm38) missense probably benign 0.03
PIT4305001:Phf20l1 UTSW 15 66,613,052 (GRCm38) missense possibly damaging 0.94
R0070:Phf20l1 UTSW 15 66,639,991 (GRCm38) missense probably damaging 1.00
R0070:Phf20l1 UTSW 15 66,639,991 (GRCm38) missense probably damaging 1.00
R0562:Phf20l1 UTSW 15 66,609,604 (GRCm38) missense probably damaging 1.00
R0605:Phf20l1 UTSW 15 66,595,122 (GRCm38) missense probably damaging 1.00
R0787:Phf20l1 UTSW 15 66,615,630 (GRCm38) splice site probably benign
R1458:Phf20l1 UTSW 15 66,604,813 (GRCm38) missense probably damaging 1.00
R1619:Phf20l1 UTSW 15 66,615,259 (GRCm38) missense possibly damaging 0.88
R1781:Phf20l1 UTSW 15 66,632,825 (GRCm38) missense probably damaging 1.00
R2360:Phf20l1 UTSW 15 66,594,920 (GRCm38) missense probably damaging 1.00
R3973:Phf20l1 UTSW 15 66,641,816 (GRCm38) missense probably damaging 1.00
R4374:Phf20l1 UTSW 15 66,604,837 (GRCm38) missense possibly damaging 0.72
R4375:Phf20l1 UTSW 15 66,615,222 (GRCm38) missense probably benign 0.00
R4554:Phf20l1 UTSW 15 66,597,367 (GRCm38) missense probably damaging 1.00
R4913:Phf20l1 UTSW 15 66,604,855 (GRCm38) missense probably benign 0.03
R5092:Phf20l1 UTSW 15 66,636,913 (GRCm38) missense possibly damaging 0.46
R5491:Phf20l1 UTSW 15 66,615,785 (GRCm38) missense possibly damaging 0.67
R5713:Phf20l1 UTSW 15 66,636,820 (GRCm38) missense possibly damaging 0.85
R6213:Phf20l1 UTSW 15 66,632,903 (GRCm38) critical splice donor site probably null
R6569:Phf20l1 UTSW 15 66,629,824 (GRCm38) missense probably damaging 1.00
R6572:Phf20l1 UTSW 15 66,609,547 (GRCm38) missense probably damaging 1.00
R6808:Phf20l1 UTSW 15 66,630,913 (GRCm38) missense probably damaging 0.99
R7100:Phf20l1 UTSW 15 66,604,840 (GRCm38) missense probably benign 0.01
R7208:Phf20l1 UTSW 15 66,604,789 (GRCm38) missense probably benign 0.05
R7436:Phf20l1 UTSW 15 66,597,750 (GRCm38) missense possibly damaging 0.92
R7466:Phf20l1 UTSW 15 66,636,884 (GRCm38) missense probably damaging 1.00
R7604:Phf20l1 UTSW 15 66,604,084 (GRCm38) missense probably benign 0.02
R7863:Phf20l1 UTSW 15 66,615,235 (GRCm38) missense possibly damaging 0.94
R7991:Phf20l1 UTSW 15 66,630,919 (GRCm38) missense possibly damaging 0.64
R8015:Phf20l1 UTSW 15 66,639,948 (GRCm38) missense possibly damaging 0.90
R8161:Phf20l1 UTSW 15 66,604,073 (GRCm38) missense probably damaging 1.00
R8228:Phf20l1 UTSW 15 66,639,940 (GRCm38) missense possibly damaging 0.81
R8857:Phf20l1 UTSW 15 66,641,932 (GRCm38) missense probably benign 0.03
R9295:Phf20l1 UTSW 15 66,641,903 (GRCm38) missense probably damaging 1.00
R9393:Phf20l1 UTSW 15 66,604,106 (GRCm38) missense probably damaging 1.00
R9442:Phf20l1 UTSW 15 66,613,039 (GRCm38) nonsense probably null
R9522:Phf20l1 UTSW 15 66,632,820 (GRCm38) missense possibly damaging 0.89
R9727:Phf20l1 UTSW 15 66,615,382 (GRCm38) missense probably benign 0.01
X0065:Phf20l1 UTSW 15 66,629,806 (GRCm38) nonsense probably null
X0065:Phf20l1 UTSW 15 66,597,678 (GRCm38) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGACAACTTCGTCTTTGATCCTG -3'
(R):5'- TTATCTGGCACACGGAGCTC -3'

Sequencing Primer
(F):5'- ACCACAATTTTTAGCGTGTTGC -3'
(R):5'- GGAGCTCCCCATCTTCTTCAAAAC -3'
Posted On 2017-10-10