Incidental Mutation 'R6126:Rimbp3'
ID 487420
Institutional Source Beutler Lab
Gene Symbol Rimbp3
Ensembl Gene ENSMUSG00000071636
Gene Name RIMS binding protein 3
Synonyms LOC239731, LOC385766, RIM-BP3
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.201) question?
Stock # R6126 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 17026467-17031846 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 17030140 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 1188 (D1188V)
Ref Sequence ENSEMBL: ENSMUSP00000127909 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169803]
AlphaFold Q3V0F0
Predicted Effect probably benign
Transcript: ENSMUST00000169803
AA Change: D1188V

PolyPhen 2 Score 0.249 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127909
Gene: ENSMUSG00000071636
AA Change: D1188V

DomainStartEndE-ValueType
coiled coil region 25 56 N/A INTRINSIC
coiled coil region 84 145 N/A INTRINSIC
low complexity region 308 324 N/A INTRINSIC
coiled coil region 395 431 N/A INTRINSIC
coiled coil region 547 610 N/A INTRINSIC
low complexity region 688 701 N/A INTRINSIC
low complexity region 769 780 N/A INTRINSIC
SH3 825 888 7.58e-8 SMART
low complexity region 913 924 N/A INTRINSIC
FN3 980 1052 2.21e-3 SMART
FN3 1073 1160 1.91e1 SMART
low complexity region 1236 1243 N/A INTRINSIC
SH3 1423 1487 5.08e-2 SMART
SH3 1539 1602 5.97e-6 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype PHENOTYPE: Male mice homozygous for a null mutation display infertility with impaired spermiogenesis and defects in sperm head and flagellum morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 89,963,881 (GRCm39) R111H probably damaging Het
Alk G A 17: 72,182,037 (GRCm39) L1329F possibly damaging Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
Atp8a2 C T 14: 60,281,775 (GRCm39) M126I probably benign Het
Cactin G A 10: 81,160,143 (GRCm39) R412H possibly damaging Het
Chd7 T C 4: 8,826,482 (GRCm39) S949P probably damaging Het
Clec11a C T 7: 43,954,345 (GRCm39) A203T probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dst T A 1: 34,267,264 (GRCm39) I5080K probably damaging Het
Ecd T C 14: 20,388,493 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fan1 T A 7: 64,014,318 (GRCm39) K638* probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fig4 A G 10: 41,141,443 (GRCm39) I272T probably damaging Het
Foxd2 C A 4: 114,765,702 (GRCm39) G106V unknown Het
Ggcx A T 6: 72,394,966 (GRCm39) M115L possibly damaging Het
Gm21976 G A 13: 98,423,821 (GRCm39) R72H unknown Het
Hsf2 T C 10: 57,372,013 (GRCm39) V38A probably damaging Het
Ifi208 A G 1: 173,505,274 (GRCm39) Y8C possibly damaging Het
Il31ra A C 13: 112,666,908 (GRCm39) L390R probably damaging Het
Kif1a A T 1: 92,947,621 (GRCm39) Y1614N probably damaging Het
Mef2b C A 8: 70,619,526 (GRCm39) T267K probably benign Het
Mfsd8 A G 3: 40,786,446 (GRCm39) probably null Het
Mnx1 G T 5: 29,683,110 (GRCm39) A55E possibly damaging Het
Muc5ac A T 7: 141,354,969 (GRCm39) I949F possibly damaging Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Ntpcr G A 8: 126,462,626 (GRCm39) probably null Het
Or12j3 T G 7: 139,953,166 (GRCm39) Y119S probably damaging Het
Otx1 T C 11: 21,946,457 (GRCm39) probably benign Het
Panx1 T A 9: 14,919,086 (GRCm39) I258F probably benign Het
Pask T C 1: 93,242,081 (GRCm39) Y1212C probably damaging Het
Pdgfra A G 5: 75,331,190 (GRCm39) K265R probably benign Het
Phf20l1 A G 15: 66,508,673 (GRCm39) H844R probably benign Het
Ppp6r1 T C 7: 4,646,376 (GRCm39) T136A possibly damaging Het
Rab35 A G 5: 115,783,767 (GRCm39) N185D probably benign Het
Rdh1 A T 10: 127,599,083 (GRCm39) D188V probably damaging Het
Robo2 C T 16: 73,717,570 (GRCm39) G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr1 A C 7: 28,775,664 (GRCm39) D2282E probably null Het
Ryr3 A G 2: 112,588,015 (GRCm39) L2642P probably damaging Het
Sez6 A T 11: 77,864,630 (GRCm39) Y530F probably damaging Het
Slc12a2 A G 18: 58,077,116 (GRCm39) Y1205C possibly damaging Het
Slc4a5 A T 6: 83,203,247 (GRCm39) H49L probably benign Het
Smchd1 A T 17: 71,677,280 (GRCm39) V1503D probably damaging Het
Spata31e3 G T 13: 50,400,326 (GRCm39) Q667K probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tex15 A G 8: 34,063,591 (GRCm39) N1007S probably benign Het
Tpk1 A T 6: 43,400,594 (GRCm39) C143S probably damaging Het
Wdr20 A T 12: 110,760,536 (GRCm39) H474L probably benign Het
Wnk4 A G 11: 101,167,174 (GRCm39) probably benign Het
Zfp292 T C 4: 34,808,497 (GRCm39) T1516A probably benign Het
Zfp462 G A 4: 55,023,573 (GRCm39) A2121T probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Rimbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Rimbp3 APN 16 17,027,607 (GRCm39) missense probably benign 0.01
IGL00786:Rimbp3 APN 16 17,029,552 (GRCm39) missense probably damaging 0.99
IGL01411:Rimbp3 APN 16 17,028,958 (GRCm39) missense probably damaging 1.00
IGL01434:Rimbp3 APN 16 17,029,566 (GRCm39) missense probably benign 0.13
IGL01895:Rimbp3 APN 16 17,029,300 (GRCm39) missense probably damaging 0.99
IGL02322:Rimbp3 APN 16 17,029,479 (GRCm39) missense probably benign 0.00
IGL02649:Rimbp3 APN 16 17,027,472 (GRCm39) nonsense probably null
IGL03285:Rimbp3 APN 16 17,031,096 (GRCm39) missense probably benign 0.16
PIT4581001:Rimbp3 UTSW 16 17,028,580 (GRCm39) missense possibly damaging 0.76
R0279:Rimbp3 UTSW 16 17,027,317 (GRCm39) missense probably benign 0.00
R0465:Rimbp3 UTSW 16 17,029,644 (GRCm39) missense possibly damaging 0.86
R0605:Rimbp3 UTSW 16 17,029,563 (GRCm39) missense probably damaging 0.99
R0674:Rimbp3 UTSW 16 17,030,601 (GRCm39) missense probably benign 0.02
R1676:Rimbp3 UTSW 16 17,028,977 (GRCm39) missense probably benign 0.13
R1780:Rimbp3 UTSW 16 17,030,496 (GRCm39) missense probably benign
R1946:Rimbp3 UTSW 16 17,028,291 (GRCm39) missense probably benign 0.10
R2113:Rimbp3 UTSW 16 17,027,539 (GRCm39) missense probably benign 0.00
R3847:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R3849:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R3850:Rimbp3 UTSW 16 17,028,163 (GRCm39) missense probably benign 0.13
R4355:Rimbp3 UTSW 16 17,027,556 (GRCm39) missense possibly damaging 0.56
R4646:Rimbp3 UTSW 16 17,030,962 (GRCm39) missense probably damaging 0.99
R4669:Rimbp3 UTSW 16 17,027,053 (GRCm39) missense possibly damaging 0.88
R4732:Rimbp3 UTSW 16 17,028,465 (GRCm39) missense possibly damaging 0.94
R4733:Rimbp3 UTSW 16 17,028,465 (GRCm39) missense possibly damaging 0.94
R5025:Rimbp3 UTSW 16 17,027,671 (GRCm39) missense probably damaging 0.99
R5039:Rimbp3 UTSW 16 17,031,195 (GRCm39) missense probably damaging 0.99
R5177:Rimbp3 UTSW 16 17,027,781 (GRCm39) missense possibly damaging 0.85
R5311:Rimbp3 UTSW 16 17,028,708 (GRCm39) missense probably benign 0.00
R5942:Rimbp3 UTSW 16 17,029,752 (GRCm39) missense probably benign 0.00
R6063:Rimbp3 UTSW 16 17,028,781 (GRCm39) missense probably damaging 1.00
R6092:Rimbp3 UTSW 16 17,030,134 (GRCm39) missense probably damaging 1.00
R6288:Rimbp3 UTSW 16 17,030,772 (GRCm39) missense probably benign 0.22
R6446:Rimbp3 UTSW 16 17,030,793 (GRCm39) missense probably benign 0.00
R6773:Rimbp3 UTSW 16 17,026,879 (GRCm39) missense probably damaging 1.00
R7017:Rimbp3 UTSW 16 17,027,610 (GRCm39) missense probably benign 0.04
R7043:Rimbp3 UTSW 16 17,028,972 (GRCm39) missense probably damaging 1.00
R7048:Rimbp3 UTSW 16 17,028,190 (GRCm39) missense probably benign 0.20
R7378:Rimbp3 UTSW 16 17,029,068 (GRCm39) missense probably benign
R7440:Rimbp3 UTSW 16 17,031,065 (GRCm39) missense possibly damaging 0.78
R7788:Rimbp3 UTSW 16 17,030,568 (GRCm39) missense probably benign 0.00
R7879:Rimbp3 UTSW 16 17,028,910 (GRCm39) missense possibly damaging 0.71
R8071:Rimbp3 UTSW 16 17,028,727 (GRCm39) missense probably benign
R8272:Rimbp3 UTSW 16 17,026,969 (GRCm39) missense possibly damaging 0.85
R8419:Rimbp3 UTSW 16 17,030,886 (GRCm39) missense probably damaging 0.97
R8819:Rimbp3 UTSW 16 17,028,771 (GRCm39) missense probably benign 0.17
R8830:Rimbp3 UTSW 16 17,026,870 (GRCm39) missense probably damaging 0.98
R8936:Rimbp3 UTSW 16 17,030,884 (GRCm39) missense probably benign
R8982:Rimbp3 UTSW 16 17,027,511 (GRCm39) missense probably benign 0.11
R9365:Rimbp3 UTSW 16 17,026,620 (GRCm39) missense possibly damaging 0.93
R9799:Rimbp3 UTSW 16 17,027,641 (GRCm39) missense possibly damaging 0.88
Z1176:Rimbp3 UTSW 16 17,027,338 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TGTAGATGGCTTCAAGGTGACC -3'
(R):5'- CCCCTGAGCTTGGCTATTTG -3'

Sequencing Primer
(F):5'- CTTCAAGGTGACCGAAGTTGC -3'
(R):5'- GTTCCATCTGAGCTCAGGC -3'
Posted On 2017-10-10