Mutagenetix > Incidental Mutations

Incidental Mutation 'R6126:Smchd1'

487422

Institutional Source

Beutler Lab

Gene Symbol

Smchd1

Ensembl Gene

ENSMUSG00000024054

Gene Name

SMC hinge domain containing 1

Synonyms

4931400A14Rik, MommeD1

MMRRC Submission

044273-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.781) question?

Stock #

R6126 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

71344489-71475343 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 71370285 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1503 (V1503D)

Ref Sequence

ENSEMBL: ENSMUSP00000121835 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000127430]

Predicted Effect

probably damaging
Transcript: ENSMUST00000127430
AA Change: V1503D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000121835
Gene: ENSMUSG00000024054
AA Change: V1503D

Domain	Start	End	E-Value	Type
Pfam:HATPase_c_3	139	299	6.8e-16	PFAM
low complexity region	451	457	N/A	INTRINSIC
internal_repeat_1	859	1087	9.1e-5	PROSPERO
low complexity region	1185	1196	N/A	INTRINSIC
internal_repeat_1	1205	1409	9.1e-5	PROSPERO
coiled coil region	1649	1680	N/A	INTRINSIC
SMC_hinge	1721	1848	1.64e-15	SMART
low complexity region	1940	1954	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180743

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000191623

Meta Mutation Damage Score

0.7304

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.8%

Validation Efficiency

93% (51/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains a hinge region domain found in members of the SMC (structural maintenance of chromosomes) protein family. [provided by RefSeq, Dec 2011]
PHENOTYPE: Females homozygous for an ENU-induced allele die at midgestation showing placental defects and hypomethylation at X-linked genes that are normally subject to X-inactivation, whereas homozygous males are viable. Females homozygous for a gene trap allele die before E13.5, whereas males remain healthy. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 53 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933434E20Rik	G	A	3: 90,056,574	R111H	probably damaging	Het
Alk	G	A	17: 71,875,042	L1329F	possibly damaging	Het
Apoh	A	T	11: 108,397,373	I106F	probably damaging	Het
Atp8a2	C	T	14: 60,044,326	M126I	probably benign	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Chd7	T	C	4: 8,826,482	S949P	probably damaging	Het
Clec11a	C	T	7: 44,304,921	A203T	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dst	T	A	1: 34,228,183	I5080K	probably damaging	Het
Ecd	T	C	14: 20,338,425		probably null	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Fan1	T	A	7: 64,364,570	K638*	probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fig4	A	G	10: 41,265,447	I272T	probably damaging	Het
Foxd2	C	A	4: 114,908,505	G106V	unknown	Het
Ggcx	A	T	6: 72,417,983	M115L	possibly damaging	Het
Gm21976	G	A	13: 98,287,313	R72H	unknown	Het
Gm906	G	T	13: 50,246,290	Q667K	probably benign	Het
Hsf2	T	C	10: 57,495,917	V38A	probably damaging	Het
Ifi208	A	G	1: 173,677,708	Y8C	possibly damaging	Het
Il31ra	A	C	13: 112,530,374	L390R	probably damaging	Het
Kif1a	A	T	1: 93,019,899	Y1614N	probably damaging	Het
Mef2b	C	A	8: 70,166,876	T267K	probably benign	Het
Mfsd8	A	G	3: 40,832,011		probably null	Het
Mnx1	G	T	5: 29,478,112	A55E	possibly damaging	Het
Muc5ac	A	T	7: 141,801,232	I949F	possibly damaging	Het
Muc6	G	T	7: 141,638,772	T1996N	possibly damaging	Het
Ntpcr	G	A	8: 125,735,887		probably null	Het
Olfr530	T	G	7: 140,373,253	Y119S	probably damaging	Het
Otx1	T	C	11: 21,996,457		probably benign	Het
Panx1	T	A	9: 15,007,790	I258F	probably benign	Het
Pask	T	C	1: 93,314,359	Y1212C	probably damaging	Het
Pdgfra	A	G	5: 75,170,529	K265R	probably benign	Het
Phf20l1	A	G	15: 66,636,824	H844R	probably benign	Het
Ppp6r1	T	C	7: 4,643,377	T136A	possibly damaging	Het
Rab35	A	G	5: 115,645,708	N185D	probably benign	Het
Rdh1	A	T	10: 127,763,214	D188V	probably damaging	Het
Rimbp3	A	T	16: 17,212,276	D1188V	probably benign	Het
Robo2	C	T	16: 73,920,682	G100S	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr1	A	C	7: 29,076,239	D2282E	probably null	Het
Ryr3	A	G	2: 112,757,670	L2642P	probably damaging	Het
Sez6	A	T	11: 77,973,804	Y530F	probably damaging	Het
Slc12a2	A	G	18: 57,944,044	Y1205C	possibly damaging	Het
Slc4a5	A	T	6: 83,226,265	H49L	probably benign	Het
Srsf11	C	T	3: 158,023,344		probably benign	Het
Tex15	A	G	8: 33,573,563	N1007S	probably benign	Het
Tpk1	A	T	6: 43,423,660	C143S	probably damaging	Het
Wdr20	A	T	12: 110,794,102	H474L	probably benign	Het
Wnk4	A	G	11: 101,276,348		probably benign	Het
Zfp292	T	C	4: 34,808,497	T1516A	probably benign	Het
Zfp462	G	A	4: 55,023,573	A2121T	probably benign	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Smchd1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Smchd1	APN	17	71465673	splice site	probably benign
IGL00529:Smchd1	APN	17	71394799	missense	probably benign	0.30
IGL00642:Smchd1	APN	17	71390432	missense	probably damaging	1.00
IGL00821:Smchd1	APN	17	71398623	missense	possibly damaging	0.92
IGL01330:Smchd1	APN	17	71436788	missense	probably benign
IGL01432:Smchd1	APN	17	71431290	missense	probably damaging	1.00
IGL01473:Smchd1	APN	17	71389750	missense	probably benign	0.00
IGL01705:Smchd1	APN	17	71381398	missense	probably damaging	1.00
IGL01787:Smchd1	APN	17	71391418	missense	probably damaging	0.99
IGL01814:Smchd1	APN	17	71378187	missense	probably benign	0.01
IGL01976:Smchd1	APN	17	71394725	nonsense	probably null
IGL01995:Smchd1	APN	17	71444020	missense	probably damaging	0.98
IGL02090:Smchd1	APN	17	71431253	missense	possibly damaging	0.86
IGL02302:Smchd1	APN	17	71358133	splice site	probably benign
IGL02309:Smchd1	APN	17	71443903	missense	probably benign	0.32
IGL02391:Smchd1	APN	17	71431259	missense	probably null	1.00
IGL02515:Smchd1	APN	17	71440957	missense	probably damaging	1.00
IGL02644:Smchd1	APN	17	71360021	splice site	probably benign
IGL03081:Smchd1	APN	17	71360191	missense	probably damaging	0.98
IGL03212:Smchd1	APN	17	71443891	missense	probably damaging	0.99
IGL03236:Smchd1	APN	17	71391430	missense	possibly damaging	0.88
IGL03297:Smchd1	APN	17	71349700	missense	probably benign	0.01
R0049:Smchd1	UTSW	17	71431236	missense	probably benign	0.01
R0254:Smchd1	UTSW	17	71411891	missense	probably benign	0.00
R0391:Smchd1	UTSW	17	71403154	missense	probably damaging	1.00
R0403:Smchd1	UTSW	17	71394902	missense	probably damaging	1.00
R0499:Smchd1	UTSW	17	71387088	missense	probably benign
R0520:Smchd1	UTSW	17	71429543	missense	possibly damaging	0.85
R0616:Smchd1	UTSW	17	71379574	missense	probably benign	0.39
R1120:Smchd1	UTSW	17	71358146	nonsense	probably null
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1469:Smchd1	UTSW	17	71349730	missense	probably damaging	1.00
R1473:Smchd1	UTSW	17	71361837	splice site	probably benign
R1484:Smchd1	UTSW	17	71378257	missense	probably benign	0.31
R1501:Smchd1	UTSW	17	71365094	missense	possibly damaging	0.54
R1718:Smchd1	UTSW	17	71448833	missense	possibly damaging	0.46
R1765:Smchd1	UTSW	17	71400201	splice site	probably benign
R1766:Smchd1	UTSW	17	71391379	missense	probably damaging	0.99
R1803:Smchd1	UTSW	17	71387006	missense	probably damaging	0.99
R1829:Smchd1	UTSW	17	71370337	missense	probably damaging	1.00
R1850:Smchd1	UTSW	17	71389771	missense	probably damaging	0.99
R1917:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1918:Smchd1	UTSW	17	71407237	missense	possibly damaging	0.48
R1936:Smchd1	UTSW	17	71463791	missense	probably damaging	1.00
R2024:Smchd1	UTSW	17	71370928	missense	probably benign	0.15
R2147:Smchd1	UTSW	17	71398588	missense	possibly damaging	0.93
R2180:Smchd1	UTSW	17	71463799	missense	probably benign	0.23
R2398:Smchd1	UTSW	17	71360141	missense	probably damaging	1.00
R2398:Smchd1	UTSW	17	71426436	splice site	probably benign
R2935:Smchd1	UTSW	17	71411905	missense	probably damaging	1.00
R3000:Smchd1	UTSW	17	71363038	missense	probably benign	0.00
R3021:Smchd1	UTSW	17	71387098	missense	possibly damaging	0.75
R3808:Smchd1	UTSW	17	71429541	missense	probably damaging	1.00
R4323:Smchd1	UTSW	17	71428275	missense	probably benign	0.00
R4486:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4487:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4488:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4489:Smchd1	UTSW	17	71407235	missense	probably benign	0.02
R4723:Smchd1	UTSW	17	71436747	nonsense	probably null
R4751:Smchd1	UTSW	17	71391468	missense	probably benign	0.01
R4798:Smchd1	UTSW	17	71360053	nonsense	probably null
R4814:Smchd1	UTSW	17	71411768	critical splice donor site	probably null
R4882:Smchd1	UTSW	17	71358239	intron	probably benign
R5088:Smchd1	UTSW	17	71431348	missense	possibly damaging	0.86
R5589:Smchd1	UTSW	17	71440961	missense	probably damaging	1.00
R5618:Smchd1	UTSW	17	71455727	missense	probably damaging	1.00
R5839:Smchd1	UTSW	17	71394862	missense	probably damaging	0.98
R5994:Smchd1	UTSW	17	71365409	missense	possibly damaging	0.89
R6009:Smchd1	UTSW	17	71440956	missense	probably damaging	1.00
R6042:Smchd1	UTSW	17	71377057	nonsense	probably null
R6082:Smchd1	UTSW	17	71349719	missense	probably benign	0.09
R6294:Smchd1	UTSW	17	71370927	missense	probably benign	0.13
R6788:Smchd1	UTSW	17	71475101	missense	probably benign	0.02
R6853:Smchd1	UTSW	17	71436743	missense	probably damaging	1.00
R6875:Smchd1	UTSW	17	71353506	missense	probably damaging	1.00
R7026:Smchd1	UTSW	17	71349667	missense	probably benign
R7045:Smchd1	UTSW	17	71415044	missense	probably benign	0.22
R7068:Smchd1	UTSW	17	71387092	missense	probably benign	0.00
R7085:Smchd1	UTSW	17	71365219	splice site	probably null
R7089:Smchd1	UTSW	17	71361960	missense	probably benign	0.00
R7145:Smchd1	UTSW	17	71378207	missense	probably benign
R7158:Smchd1	UTSW	17	71400150	missense	probably damaging	0.99
R7180:Smchd1	UTSW	17	71394823	missense	probably damaging	0.99
R7183:Smchd1	UTSW	17	71353516	missense	probably benign	0.00
R7214:Smchd1	UTSW	17	71345364	missense	probably benign	0.15
R7414:Smchd1	UTSW	17	71475079	missense	probably damaging	0.99
R7512:Smchd1	UTSW	17	71381369	missense	possibly damaging	0.51
R7631:Smchd1	UTSW	17	71398689	missense	probably benign	0.10
R7641:Smchd1	UTSW	17	71390479	missense	probably benign	0.00
R7709:Smchd1	UTSW	17	71358198	missense	probably damaging	1.00
R7768:Smchd1	UTSW	17	71411911	missense	probably damaging	1.00
R7789:Smchd1	UTSW	17	71475301	start gained	probably benign
R7898:Smchd1	UTSW	17	71377818	splice site	probably null
R7965:Smchd1	UTSW	17	71455626	missense	possibly damaging	0.65
R8177:Smchd1	UTSW	17	71390453	missense	probably benign	0.28
R8359:Smchd1	UTSW	17	71431243	missense	probably damaging	0.99
R8370:Smchd1	UTSW	17	71394913	missense	probably benign	0.22
R8426:Smchd1	UTSW	17	71448603	missense	probably damaging	1.00
R8443:Smchd1	UTSW	17	71407249	missense	probably benign	0.18
Z1176:Smchd1	UTSW	17	71361841	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- TCCTGCAGGTTTTAACTGAATGATC -3'
(R):5'- CAGTACCAGACTTTGTCCTGAG -3'

Sequencing Primer
(F):5'- AGCCATTCTGAACCTGAC -3'
(R):5'- GACCAGTGATTGATGATAGATAACTG -3'

Posted On

2017-10-10