Incidental Mutation 'R6126:Dnase1l1'
ID 487425
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Name deoxyribonuclease 1-like 1
Synonyms 2310005K03Rik, G4.8, Dnase1ll, Dnl1ll
MMRRC Submission 044273-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.067) question?
Stock # R6126 (G1)
Quality Score 221.999
Status Validated
Chromosome X
Chromosomal Location 73316823-73325939 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 73320644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000151702] [ENSMUST00000135690]
AlphaFold Q9D7J6
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 89,963,881 (GRCm39) R111H probably damaging Het
Alk G A 17: 72,182,037 (GRCm39) L1329F possibly damaging Het
Apoh A T 11: 108,288,199 (GRCm39) I106F probably damaging Het
Atp8a2 C T 14: 60,281,775 (GRCm39) M126I probably benign Het
Cactin G A 10: 81,160,143 (GRCm39) R412H possibly damaging Het
Chd7 T C 4: 8,826,482 (GRCm39) S949P probably damaging Het
Clec11a C T 7: 43,954,345 (GRCm39) A203T probably damaging Het
Dst T A 1: 34,267,264 (GRCm39) I5080K probably damaging Het
Ecd T C 14: 20,388,493 (GRCm39) probably null Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Fan1 T A 7: 64,014,318 (GRCm39) K638* probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fig4 A G 10: 41,141,443 (GRCm39) I272T probably damaging Het
Foxd2 C A 4: 114,765,702 (GRCm39) G106V unknown Het
Ggcx A T 6: 72,394,966 (GRCm39) M115L possibly damaging Het
Gm21976 G A 13: 98,423,821 (GRCm39) R72H unknown Het
Hsf2 T C 10: 57,372,013 (GRCm39) V38A probably damaging Het
Ifi208 A G 1: 173,505,274 (GRCm39) Y8C possibly damaging Het
Il31ra A C 13: 112,666,908 (GRCm39) L390R probably damaging Het
Kif1a A T 1: 92,947,621 (GRCm39) Y1614N probably damaging Het
Mef2b C A 8: 70,619,526 (GRCm39) T267K probably benign Het
Mfsd8 A G 3: 40,786,446 (GRCm39) probably null Het
Mnx1 G T 5: 29,683,110 (GRCm39) A55E possibly damaging Het
Muc5ac A T 7: 141,354,969 (GRCm39) I949F possibly damaging Het
Muc6 G T 7: 141,218,685 (GRCm39) T1996N possibly damaging Het
Ntpcr G A 8: 126,462,626 (GRCm39) probably null Het
Or12j3 T G 7: 139,953,166 (GRCm39) Y119S probably damaging Het
Otx1 T C 11: 21,946,457 (GRCm39) probably benign Het
Panx1 T A 9: 14,919,086 (GRCm39) I258F probably benign Het
Pask T C 1: 93,242,081 (GRCm39) Y1212C probably damaging Het
Pdgfra A G 5: 75,331,190 (GRCm39) K265R probably benign Het
Phf20l1 A G 15: 66,508,673 (GRCm39) H844R probably benign Het
Ppp6r1 T C 7: 4,646,376 (GRCm39) T136A possibly damaging Het
Rab35 A G 5: 115,783,767 (GRCm39) N185D probably benign Het
Rdh1 A T 10: 127,599,083 (GRCm39) D188V probably damaging Het
Rimbp3 A T 16: 17,030,140 (GRCm39) D1188V probably benign Het
Robo2 C T 16: 73,717,570 (GRCm39) G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr1 A C 7: 28,775,664 (GRCm39) D2282E probably null Het
Ryr3 A G 2: 112,588,015 (GRCm39) L2642P probably damaging Het
Sez6 A T 11: 77,864,630 (GRCm39) Y530F probably damaging Het
Slc12a2 A G 18: 58,077,116 (GRCm39) Y1205C possibly damaging Het
Slc4a5 A T 6: 83,203,247 (GRCm39) H49L probably benign Het
Smchd1 A T 17: 71,677,280 (GRCm39) V1503D probably damaging Het
Spata31e3 G T 13: 50,400,326 (GRCm39) Q667K probably benign Het
Srsf11 C T 3: 157,728,981 (GRCm39) probably benign Het
Tex15 A G 8: 34,063,591 (GRCm39) N1007S probably benign Het
Tpk1 A T 6: 43,400,594 (GRCm39) C143S probably damaging Het
Wdr20 A T 12: 110,760,536 (GRCm39) H474L probably benign Het
Wnk4 A G 11: 101,167,174 (GRCm39) probably benign Het
Zfp292 T C 4: 34,808,497 (GRCm39) T1516A probably benign Het
Zfp462 G A 4: 55,023,573 (GRCm39) A2121T probably benign Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4752:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4753:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4814:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4815:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4846:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4861:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4862:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4872:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4873:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4875:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4978:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4979:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4980:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4981:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4982:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R4983:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5039:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5084:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5085:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5086:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5087:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5106:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5107:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5108:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5109:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5137:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5171:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5266:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5296:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5330:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5417:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5418:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5419:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5448:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5466:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R5467:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6128:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6129:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6130:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6232:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6233:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6234:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6242:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6305:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6306:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6329:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6343:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6344:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6396:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6397:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6449:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6450:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6585:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6586:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6646:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6679:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6681:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6845:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R6847:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
R8526:Dnase1l1 UTSW X 73,320,644 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTGGTACCAGAGTGGCTG -3'
(R):5'- CTTTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On 2017-10-10