Incidental Mutation 'R6126:Dnase1l1'
ID487425
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Namedeoxyribonuclease 1-like 1
SynonymsDnase1ll, G4.8, Dnl1ll, 2310005K03Rik
MMRRC Submission 044273-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6126 (G1)
Quality Score221.999
Status Validated
ChromosomeX
Chromosomal Location74273217-74282337 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74277038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 93% (51/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933434E20Rik G A 3: 90,056,574 R111H probably damaging Het
Alk G A 17: 71,875,042 L1329F possibly damaging Het
Apoh A T 11: 108,397,373 I106F probably damaging Het
Atp8a2 C T 14: 60,044,326 M126I probably benign Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Chd7 T C 4: 8,826,482 S949P probably damaging Het
Clec11a C T 7: 44,304,921 A203T probably damaging Het
Dst T A 1: 34,228,183 I5080K probably damaging Het
Ecd T C 14: 20,338,425 probably null Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Fan1 T A 7: 64,364,570 K638* probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fig4 A G 10: 41,265,447 I272T probably damaging Het
Foxd2 C A 4: 114,908,505 G106V unknown Het
Ggcx A T 6: 72,417,983 M115L possibly damaging Het
Gm21976 G A 13: 98,287,313 R72H unknown Het
Gm906 G T 13: 50,246,290 Q667K probably benign Het
Hsf2 T C 10: 57,495,917 V38A probably damaging Het
Ifi208 A G 1: 173,677,708 Y8C possibly damaging Het
Il31ra A C 13: 112,530,374 L390R probably damaging Het
Kif1a A T 1: 93,019,899 Y1614N probably damaging Het
Mef2b C A 8: 70,166,876 T267K probably benign Het
Mfsd8 A G 3: 40,832,011 probably null Het
Mnx1 G T 5: 29,478,112 A55E possibly damaging Het
Muc5ac A T 7: 141,801,232 I949F possibly damaging Het
Muc6 G T 7: 141,638,772 T1996N possibly damaging Het
Ntpcr G A 8: 125,735,887 probably null Het
Olfr530 T G 7: 140,373,253 Y119S probably damaging Het
Otx1 T C 11: 21,996,457 probably benign Het
Panx1 T A 9: 15,007,790 I258F probably benign Het
Pask T C 1: 93,314,359 Y1212C probably damaging Het
Pdgfra A G 5: 75,170,529 K265R probably benign Het
Phf20l1 A G 15: 66,636,824 H844R probably benign Het
Ppp6r1 T C 7: 4,643,377 T136A possibly damaging Het
Rab35 A G 5: 115,645,708 N185D probably benign Het
Rdh1 A T 10: 127,763,214 D188V probably damaging Het
Rimbp3 A T 16: 17,212,276 D1188V probably benign Het
Robo2 C T 16: 73,920,682 G100S probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr1 A C 7: 29,076,239 D2282E probably null Het
Ryr3 A G 2: 112,757,670 L2642P probably damaging Het
Sez6 A T 11: 77,973,804 Y530F probably damaging Het
Slc12a2 A G 18: 57,944,044 Y1205C possibly damaging Het
Slc4a5 A T 6: 83,226,265 H49L probably benign Het
Smchd1 A T 17: 71,370,285 V1503D probably damaging Het
Srsf11 C T 3: 158,023,344 probably benign Het
Tex15 A G 8: 33,573,563 N1007S probably benign Het
Tpk1 A T 6: 43,423,660 C143S probably damaging Het
Wdr20 A T 12: 110,794,102 H474L probably benign Het
Wnk4 A G 11: 101,276,348 probably benign Het
Zfp292 T C 4: 34,808,497 T1516A probably benign Het
Zfp462 G A 4: 55,023,573 A2121T probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4752:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4753:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4814:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4815:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4846:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4861:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4862:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4872:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4873:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4875:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4978:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4979:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4980:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4981:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4982:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4983:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5039:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5084:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5085:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5086:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5087:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5106:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5107:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5108:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5109:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5137:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5171:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5266:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5296:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5330:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5417:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5418:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5419:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5448:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5466:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5467:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6128:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6129:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6130:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6232:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6233:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6234:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6242:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6305:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6306:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6329:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6343:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6344:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6396:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6397:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6449:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6585:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6586:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6646:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6679:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6681:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6845:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6847:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AAGATTGGTACCAGAGTGGCTG -3'
(R):5'- CTTTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On2017-10-10