Incidental Mutation 'R6127:Mertk'
ID487429
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission 044274-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6127 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 128738291 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 222 (V222F)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably damaging
Transcript: ENSMUST00000014505
AA Change: V222F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V222F

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Meta Mutation Damage Score 0.1698 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik A G 2: 154,549,589 E92G probably damaging Het
4931429L15Rik T A 9: 46,308,922 D104V probably damaging Het
Actl9 T C 17: 33,433,380 V138A probably benign Het
Agl T A 3: 116,758,329 I1204F probably damaging Het
Akna G T 4: 63,368,119 T1381N possibly damaging Het
Atm A C 9: 53,524,509 L167W probably damaging Het
Atp2b2 C T 6: 113,813,877 E189K probably damaging Het
Bend7 A G 2: 4,763,277 D348G probably damaging Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Carmil1 T C 13: 24,036,352 T726A probably benign Het
Csmd3 T A 15: 47,650,228 I2829F probably damaging Het
Ddx50 A T 10: 62,621,563 probably null Het
Epha5 T G 5: 84,071,094 K937N probably damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fuca1 T A 4: 135,934,811 I350N probably damaging Het
Hagh G T 17: 24,861,004 M152I probably damaging Het
Hexdc T C 11: 121,216,999 V185A possibly damaging Het
Ireb2 A G 9: 54,882,368 T109A probably benign Het
Kcnh2 A G 5: 24,325,003 Y702H probably damaging Het
Leng1 G A 7: 3,662,867 P157L probably damaging Het
Maea C T 5: 33,335,518 probably benign Het
Mroh2a T C 1: 88,234,612 probably null Het
Muc13 G A 16: 33,798,947 A22T unknown Het
Muc16 T A 9: 18,657,878 H1115L unknown Het
Olfr1156 T A 2: 87,949,361 S291C probably damaging Het
Olfr1389 C A 11: 49,430,806 T110K probably damaging Het
Olfr291 T A 7: 84,857,202 L278M probably damaging Het
Olfr816 A G 10: 129,911,415 Y288H probably damaging Het
Pak7 G A 2: 136,087,406 P619L probably damaging Het
Pcdh17 A G 14: 84,533,060 K993E probably damaging Het
Pcdhga3 A T 18: 37,674,704 Q70L probably damaging Het
Pcdhgb5 C A 18: 37,732,879 R576S probably damaging Het
Pold1 T C 7: 44,542,121 Y147C probably damaging Het
Prag1 T C 8: 36,147,401 L1369P unknown Het
Psg29 T A 7: 17,211,746 F414I probably benign Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rp1 C A 1: 4,349,311 S526I possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setd7 G A 3: 51,530,081 T251I probably damaging Het
Slc25a41 T A 17: 57,034,914 Y145F probably damaging Het
Stag1 T C 9: 100,951,697 V1121A probably benign Het
Svip T C 7: 52,003,453 T38A probably benign Het
Tacc2 A T 7: 130,626,115 H1510L possibly damaging Het
Trav19 A G 14: 53,845,542 T25A probably benign Het
Trip4 A T 9: 65,866,470 probably null Het
Tulp1 T A 17: 28,356,150 H447L probably benign Het
Vmn1r200 A T 13: 22,395,203 T59S probably benign Het
Vmn2r51 A T 7: 10,105,631 L10H probably damaging Het
Wee2 T C 6: 40,449,767 Y157H probably damaging Het
Xrn1 T C 9: 95,969,489 S187P probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4664:Mertk UTSW 2 128801212 missense probably benign 0.24
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGGGAGTCAGAAACCTC -3'
(R):5'- ATCGGCACCAAAGTTTTGTC -3'

Sequencing Primer
(F):5'- GTGACAATTGGCTATGTCAGACC -3'
(R):5'- GCACCAAAGTTTTGTCACCTTTACAG -3'
Posted On2017-10-10