Mutagenetix > Incidental Mutations

Incidental Mutation 'R6127:Mertk'

487429

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

044274-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.147) question?

Stock #

R6127 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 128738291 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Phenylalanine at position 222 (V222F)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

Predicted Effect

probably damaging
Transcript: ENSMUST00000014505
AA Change: V222F

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V222F

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Meta Mutation Damage Score

0.1698

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.2%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700003F12Rik	A	G	2: 154,549,589	E92G	probably damaging	Het
4931429L15Rik	T	A	9: 46,308,922	D104V	probably damaging	Het
Actl9	T	C	17: 33,433,380	V138A	probably benign	Het
Agl	T	A	3: 116,758,329	I1204F	probably damaging	Het
Akna	G	T	4: 63,368,119	T1381N	possibly damaging	Het
Atm	A	C	9: 53,524,509	L167W	probably damaging	Het
Atp2b2	C	T	6: 113,813,877	E189K	probably damaging	Het
Bend7	A	G	2: 4,763,277	D348G	probably damaging	Het
Cactin	G	A	10: 81,324,309	R412H	possibly damaging	Het
Carmil1	T	C	13: 24,036,352	T726A	probably benign	Het
Csmd3	T	A	15: 47,650,228	I2829F	probably damaging	Het
Ddx50	A	T	10: 62,621,563		probably null	Het
Epha5	T	G	5: 84,071,094	K937N	probably damaging	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fuca1	T	A	4: 135,934,811	I350N	probably damaging	Het
Hagh	G	T	17: 24,861,004	M152I	probably damaging	Het
Hexdc	T	C	11: 121,216,999	V185A	possibly damaging	Het
Ireb2	A	G	9: 54,882,368	T109A	probably benign	Het
Kcnh2	A	G	5: 24,325,003	Y702H	probably damaging	Het
Leng1	G	A	7: 3,662,867	P157L	probably damaging	Het
Maea	C	T	5: 33,335,518		probably benign	Het
Mroh2a	T	C	1: 88,234,612		probably null	Het
Muc13	G	A	16: 33,798,947	A22T	unknown	Het
Muc16	T	A	9: 18,657,878	H1115L	unknown	Het
Olfr1156	T	A	2: 87,949,361	S291C	probably damaging	Het
Olfr1389	C	A	11: 49,430,806	T110K	probably damaging	Het
Olfr291	T	A	7: 84,857,202	L278M	probably damaging	Het
Olfr816	A	G	10: 129,911,415	Y288H	probably damaging	Het
Pak7	G	A	2: 136,087,406	P619L	probably damaging	Het
Pcdh17	A	G	14: 84,533,060	K993E	probably damaging	Het
Pcdhga3	A	T	18: 37,674,704	Q70L	probably damaging	Het
Pcdhgb5	C	A	18: 37,732,879	R576S	probably damaging	Het
Pold1	T	C	7: 44,542,121	Y147C	probably damaging	Het
Prag1	T	C	8: 36,147,401	L1369P	unknown	Het
Psg29	T	A	7: 17,211,746	F414I	probably benign	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rp1	C	A	1: 4,349,311	S526I	possibly damaging	Het
Rsrc1	C	T	3: 66,994,649	P44L	unknown	Het
Setd7	G	A	3: 51,530,081	T251I	probably damaging	Het
Slc25a41	T	A	17: 57,034,914	Y145F	probably damaging	Het
Stag1	T	C	9: 100,951,697	V1121A	probably benign	Het
Svip	T	C	7: 52,003,453	T38A	probably benign	Het
Tacc2	A	T	7: 130,626,115	H1510L	possibly damaging	Het
Trav19	A	G	14: 53,845,542	T25A	probably benign	Het
Trip4	A	T	9: 65,866,470		probably null	Het
Tulp1	T	A	17: 28,356,150	H447L	probably benign	Het
Vmn1r200	A	T	13: 22,395,203	T59S	probably benign	Het
Vmn2r51	A	T	7: 10,105,631	L10H	probably damaging	Het
Wee2	T	C	6: 40,449,767	Y157H	probably damaging	Het
Xrn1	T	C	9: 95,969,489	S187P	probably damaging	Het
Zfp647	G	A	15: 76,912,085	P125L	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGGGAGTCAGAAACCTC -3'
(R):5'- ATCGGCACCAAAGTTTTGTC -3'

Sequencing Primer
(F):5'- GTGACAATTGGCTATGTCAGACC -3'
(R):5'- GCACCAAAGTTTTGTCACCTTTACAG -3'

Posted On

2017-10-10