Incidental Mutation 'R6127:Vmn2r51'
ID 487444
Institutional Source Beutler Lab
Gene Symbol Vmn2r51
Ensembl Gene ENSMUSG00000058685
Gene Name vomeronasal 2, receptor 51
Synonyms
MMRRC Submission 044274-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R6127 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 9821125-9839586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 9839558 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 10 (L10H)
Ref Sequence ENSEMBL: ENSMUSP00000092459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094863]
AlphaFold L7N215
Predicted Effect probably damaging
Transcript: ENSMUST00000094863
AA Change: L10H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000092459
Gene: ENSMUSG00000058685
AA Change: L10H

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 73 469 2.4e-31 PFAM
Pfam:NCD3G 512 565 8.1e-21 PFAM
Pfam:7tm_3 598 833 2.7e-54 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik A G 2: 154,391,509 (GRCm39) E92G probably damaging Het
4931429L15Rik T A 9: 46,220,220 (GRCm39) D104V probably damaging Het
Actl9 T C 17: 33,652,354 (GRCm39) V138A probably benign Het
Agl T A 3: 116,551,978 (GRCm39) I1204F probably damaging Het
Akna G T 4: 63,286,356 (GRCm39) T1381N possibly damaging Het
Atm A C 9: 53,435,809 (GRCm39) L167W probably damaging Het
Atp2b2 C T 6: 113,790,838 (GRCm39) E189K probably damaging Het
Bend7 A G 2: 4,768,088 (GRCm39) D348G probably damaging Het
Cactin G A 10: 81,160,143 (GRCm39) R412H possibly damaging Het
Carmil1 T C 13: 24,220,335 (GRCm39) T726A probably benign Het
Csmd3 T A 15: 47,513,624 (GRCm39) I2829F probably damaging Het
Ddx50 A T 10: 62,457,342 (GRCm39) probably null Het
Epha5 T G 5: 84,218,953 (GRCm39) K937N probably damaging Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fuca1 T A 4: 135,662,122 (GRCm39) I350N probably damaging Het
Hagh G T 17: 25,079,978 (GRCm39) M152I probably damaging Het
Hexd T C 11: 121,107,825 (GRCm39) V185A possibly damaging Het
Ireb2 A G 9: 54,789,652 (GRCm39) T109A probably benign Het
Kcnh2 A G 5: 24,530,001 (GRCm39) Y702H probably damaging Het
Leng1 G A 7: 3,665,866 (GRCm39) P157L probably damaging Het
Maea C T 5: 33,492,862 (GRCm39) probably benign Het
Mertk G T 2: 128,580,211 (GRCm39) V222F probably damaging Het
Mroh2a T C 1: 88,162,334 (GRCm39) probably null Het
Muc13 G A 16: 33,619,317 (GRCm39) A22T unknown Het
Muc16 T A 9: 18,569,174 (GRCm39) H1115L unknown Het
Or2y1d C A 11: 49,321,633 (GRCm39) T110K probably damaging Het
Or5ae2 T A 7: 84,506,410 (GRCm39) L278M probably damaging Het
Or5l13 T A 2: 87,779,705 (GRCm39) S291C probably damaging Het
Or6c69 A G 10: 129,747,284 (GRCm39) Y288H probably damaging Het
Pak5 G A 2: 135,929,326 (GRCm39) P619L probably damaging Het
Pcdh17 A G 14: 84,770,500 (GRCm39) K993E probably damaging Het
Pcdhga3 A T 18: 37,807,757 (GRCm39) Q70L probably damaging Het
Pcdhgb5 C A 18: 37,865,932 (GRCm39) R576S probably damaging Het
Pold1 T C 7: 44,191,545 (GRCm39) Y147C probably damaging Het
Prag1 T C 8: 36,614,555 (GRCm39) L1369P unknown Het
Psg29 T A 7: 16,945,671 (GRCm39) F414I probably benign Het
Robo1 A T 16: 72,809,956 (GRCm39) M1235L probably benign Het
Rp1 C A 1: 4,419,534 (GRCm39) S526I possibly damaging Het
Rsrc1 C T 3: 66,901,982 (GRCm39) P44L unknown Het
Setd7 G A 3: 51,437,502 (GRCm39) T251I probably damaging Het
Slc25a41 T A 17: 57,341,914 (GRCm39) Y145F probably damaging Het
Stag1 T C 9: 100,833,750 (GRCm39) V1121A probably benign Het
Svip T C 7: 51,653,201 (GRCm39) T38A probably benign Het
Tacc2 A T 7: 130,227,845 (GRCm39) H1510L possibly damaging Het
Trav19 A G 14: 54,082,999 (GRCm39) T25A probably benign Het
Trip4 A T 9: 65,773,752 (GRCm39) probably null Het
Tulp1 T A 17: 28,575,124 (GRCm39) H447L probably benign Het
Vmn1r200 A T 13: 22,579,373 (GRCm39) T59S probably benign Het
Wee2 T C 6: 40,426,701 (GRCm39) Y157H probably damaging Het
Xrn1 T C 9: 95,851,542 (GRCm39) S187P probably damaging Het
Zfp647 G A 15: 76,796,285 (GRCm39) P125L probably damaging Het
Other mutations in Vmn2r51
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01398:Vmn2r51 APN 7 9,836,341 (GRCm39) missense probably benign
IGL01574:Vmn2r51 APN 7 9,836,381 (GRCm39) missense probably damaging 1.00
IGL01743:Vmn2r51 APN 7 9,834,154 (GRCm39) missense probably damaging 0.98
IGL01820:Vmn2r51 APN 7 9,839,409 (GRCm39) missense probably damaging 1.00
IGL02563:Vmn2r51 APN 7 9,834,243 (GRCm39) missense probably benign 0.00
IGL02825:Vmn2r51 APN 7 9,832,046 (GRCm39) splice site probably benign
IGL02834:Vmn2r51 APN 7 9,832,063 (GRCm39) nonsense probably null
R0617:Vmn2r51 UTSW 7 9,834,396 (GRCm39) missense possibly damaging 0.65
R0967:Vmn2r51 UTSW 7 9,834,012 (GRCm39) missense probably damaging 0.97
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1465:Vmn2r51 UTSW 7 9,834,249 (GRCm39) missense probably damaging 1.00
R1559:Vmn2r51 UTSW 7 9,836,373 (GRCm39) missense possibly damaging 0.87
R1559:Vmn2r51 UTSW 7 9,836,372 (GRCm39) missense possibly damaging 0.58
R1598:Vmn2r51 UTSW 7 9,839,432 (GRCm39) missense probably benign
R1754:Vmn2r51 UTSW 7 9,833,873 (GRCm39) missense probably benign 0.04
R1836:Vmn2r51 UTSW 7 9,832,091 (GRCm39) nonsense probably null
R1836:Vmn2r51 UTSW 7 9,832,090 (GRCm39) nonsense probably null
R3151:Vmn2r51 UTSW 7 9,833,968 (GRCm39) missense probably damaging 1.00
R4566:Vmn2r51 UTSW 7 9,836,341 (GRCm39) missense probably benign
R4933:Vmn2r51 UTSW 7 9,832,247 (GRCm39) missense probably damaging 1.00
R5004:Vmn2r51 UTSW 7 9,821,932 (GRCm39) missense probably benign
R5050:Vmn2r51 UTSW 7 9,834,349 (GRCm39) missense probably damaging 0.99
R5510:Vmn2r51 UTSW 7 9,836,545 (GRCm39) missense possibly damaging 0.95
R5559:Vmn2r51 UTSW 7 9,826,128 (GRCm39) missense probably damaging 1.00
R6154:Vmn2r51 UTSW 7 9,821,921 (GRCm39) missense possibly damaging 0.74
R6304:Vmn2r51 UTSW 7 9,832,164 (GRCm39) missense probably benign 0.00
R6370:Vmn2r51 UTSW 7 9,832,143 (GRCm39) missense probably damaging 1.00
R6471:Vmn2r51 UTSW 7 9,836,510 (GRCm39) missense possibly damaging 0.48
R6800:Vmn2r51 UTSW 7 9,832,191 (GRCm39) missense probably damaging 0.99
R6883:Vmn2r51 UTSW 7 9,834,025 (GRCm39) missense possibly damaging 0.75
R7191:Vmn2r51 UTSW 7 9,834,480 (GRCm39) missense probably null 1.00
R7246:Vmn2r51 UTSW 7 9,836,428 (GRCm39) missense probably benign 0.00
R8939:Vmn2r51 UTSW 7 9,833,953 (GRCm39) missense possibly damaging 0.85
R9154:Vmn2r51 UTSW 7 9,839,480 (GRCm39) missense probably damaging 0.96
R9428:Vmn2r51 UTSW 7 9,833,712 (GRCm39) critical splice donor site probably benign
R9451:Vmn2r51 UTSW 7 9,833,816 (GRCm39) missense probably damaging 1.00
R9729:Vmn2r51 UTSW 7 9,839,479 (GRCm39) missense probably benign 0.00
R9767:Vmn2r51 UTSW 7 9,839,407 (GRCm39) missense probably benign 0.09
Z1176:Vmn2r51 UTSW 7 9,833,835 (GRCm39) missense probably benign 0.12
Z1176:Vmn2r51 UTSW 7 9,821,984 (GRCm39) missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TTCATCCTCAGAGCACTCAAG -3'
(R):5'- AGTTTCTTCCAGGGCTCAGG -3'

Sequencing Primer
(F):5'- CAATGGGTGTCTGAACAG -3'
(R):5'- TTTCTTCCAGGGCTCAGGAGAAAC -3'
Posted On 2017-10-10