Incidental Mutation 'R6127:Carmil1'
ID487463
Institutional Source Beutler Lab
Gene Symbol Carmil1
Ensembl Gene ENSMUSG00000021338
Gene Namecapping protein regulator and myosin 1 linker 1
Synonyms1110037D04Rik, Lrrc16, Lrrc16a, Carmil
MMRRC Submission 044274-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6127 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location24012344-24280795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24036352 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 726 (T726A)
Ref Sequence ENSEMBL: ENSMUSP00000126522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072889] [ENSMUST00000110398] [ENSMUST00000125901]
Predicted Effect probably benign
Transcript: ENSMUST00000072889
AA Change: T1130A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072662
Gene: ENSMUSG00000021338
AA Change: T1130A

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
Blast:LRR 451 484 7e-9 BLAST
LRR 574 601 8.81e-2 SMART
Blast:LRR 602 629 6e-10 BLAST
low complexity region 745 758 N/A INTRINSIC
Pfam:CARMIL_C 790 1083 1.1e-101 PFAM
low complexity region 1131 1147 N/A INTRINSIC
low complexity region 1245 1251 N/A INTRINSIC
low complexity region 1253 1268 N/A INTRINSIC
low complexity region 1287 1296 N/A INTRINSIC
low complexity region 1317 1332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110398
AA Change: T1126A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000106028
Gene: ENSMUSG00000021338
AA Change: T1126A

DomainStartEndE-ValueType
low complexity region 19 37 N/A INTRINSIC
LRR 245 272 2.42e1 SMART
LRR 275 302 1.04e1 SMART
LRR 304 331 3.1e0 SMART
LRR 336 363 5.66e1 SMART
Blast:LRR 423 450 9e-8 BLAST
LRR 451 480 3.15e1 SMART
Pfam:LRR_6 481 507 1.9e-2 PFAM
LRR 570 597 8.81e-2 SMART
Blast:LRR 598 625 6e-10 BLAST
low complexity region 741 754 N/A INTRINSIC
low complexity region 879 888 N/A INTRINSIC
PDB:3LK3|T 964 1076 1e-56 PDB
low complexity region 1127 1143 N/A INTRINSIC
low complexity region 1241 1247 N/A INTRINSIC
low complexity region 1249 1264 N/A INTRINSIC
low complexity region 1283 1292 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000125901
AA Change: T726A

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000126522
Gene: ENSMUSG00000021338
AA Change: T726A

DomainStartEndE-ValueType
Blast:LRR 13 40 5e-8 BLAST
Blast:LRR 41 74 4e-9 BLAST
Pfam:LRR_6 75 101 4.4e-2 PFAM
Pfam:LRR_6 164 187 1.6e-3 PFAM
Blast:LRR 192 219 7e-10 BLAST
low complexity region 335 348 N/A INTRINSIC
low complexity region 473 482 N/A INTRINSIC
PDB:3LK3|T 564 676 4e-57 PDB
low complexity region 727 743 N/A INTRINSIC
low complexity region 841 847 N/A INTRINSIC
low complexity region 849 864 N/A INTRINSIC
low complexity region 883 892 N/A INTRINSIC
low complexity region 913 925 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147261
Meta Mutation Damage Score 0.0637 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.2%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700003F12Rik A G 2: 154,549,589 E92G probably damaging Het
4931429L15Rik T A 9: 46,308,922 D104V probably damaging Het
Actl9 T C 17: 33,433,380 V138A probably benign Het
Agl T A 3: 116,758,329 I1204F probably damaging Het
Akna G T 4: 63,368,119 T1381N possibly damaging Het
Atm A C 9: 53,524,509 L167W probably damaging Het
Atp2b2 C T 6: 113,813,877 E189K probably damaging Het
Bend7 A G 2: 4,763,277 D348G probably damaging Het
Cactin G A 10: 81,324,309 R412H possibly damaging Het
Csmd3 T A 15: 47,650,228 I2829F probably damaging Het
Ddx50 A T 10: 62,621,563 probably null Het
Epha5 T G 5: 84,071,094 K937N probably damaging Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fuca1 T A 4: 135,934,811 I350N probably damaging Het
Hagh G T 17: 24,861,004 M152I probably damaging Het
Hexdc T C 11: 121,216,999 V185A possibly damaging Het
Ireb2 A G 9: 54,882,368 T109A probably benign Het
Kcnh2 A G 5: 24,325,003 Y702H probably damaging Het
Leng1 G A 7: 3,662,867 P157L probably damaging Het
Maea C T 5: 33,335,518 probably benign Het
Mertk G T 2: 128,738,291 V222F probably damaging Het
Mroh2a T C 1: 88,234,612 probably null Het
Muc13 G A 16: 33,798,947 A22T unknown Het
Muc16 T A 9: 18,657,878 H1115L unknown Het
Olfr1156 T A 2: 87,949,361 S291C probably damaging Het
Olfr1389 C A 11: 49,430,806 T110K probably damaging Het
Olfr291 T A 7: 84,857,202 L278M probably damaging Het
Olfr816 A G 10: 129,911,415 Y288H probably damaging Het
Pak7 G A 2: 136,087,406 P619L probably damaging Het
Pcdh17 A G 14: 84,533,060 K993E probably damaging Het
Pcdhga3 A T 18: 37,674,704 Q70L probably damaging Het
Pcdhgb5 C A 18: 37,732,879 R576S probably damaging Het
Pold1 T C 7: 44,542,121 Y147C probably damaging Het
Prag1 T C 8: 36,147,401 L1369P unknown Het
Psg29 T A 7: 17,211,746 F414I probably benign Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rp1 C A 1: 4,349,311 S526I possibly damaging Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Setd7 G A 3: 51,530,081 T251I probably damaging Het
Slc25a41 T A 17: 57,034,914 Y145F probably damaging Het
Stag1 T C 9: 100,951,697 V1121A probably benign Het
Svip T C 7: 52,003,453 T38A probably benign Het
Tacc2 A T 7: 130,626,115 H1510L possibly damaging Het
Trav19 A G 14: 53,845,542 T25A probably benign Het
Trip4 A T 9: 65,866,470 probably null Het
Tulp1 T A 17: 28,356,150 H447L probably benign Het
Vmn1r200 A T 13: 22,395,203 T59S probably benign Het
Vmn2r51 A T 7: 10,105,631 L10H probably damaging Het
Wee2 T C 6: 40,449,767 Y157H probably damaging Het
Xrn1 T C 9: 95,969,489 S187P probably damaging Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Other mutations in Carmil1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Carmil1 APN 13 24111838 missense possibly damaging 0.68
IGL00392:Carmil1 APN 13 24094491 missense probably damaging 1.00
IGL00943:Carmil1 APN 13 24111886 missense possibly damaging 0.48
IGL01375:Carmil1 APN 13 24094471 missense possibly damaging 0.88
IGL02043:Carmil1 APN 13 24024316 unclassified probably benign
IGL02122:Carmil1 APN 13 24036558 missense possibly damaging 0.95
IGL02178:Carmil1 APN 13 24094403 missense probably damaging 1.00
IGL02264:Carmil1 APN 13 24075716 missense possibly damaging 0.95
IGL02269:Carmil1 APN 13 24155410 nonsense probably null
IGL02546:Carmil1 APN 13 24115499 missense probably damaging 0.98
IGL02740:Carmil1 APN 13 24094518 missense probably damaging 0.98
IGL02876:Carmil1 APN 13 24154668 unclassified probably benign
IGL02976:Carmil1 APN 13 24092551 missense possibly damaging 0.96
IGL03012:Carmil1 APN 13 24036372 missense probably benign 0.19
IGL03107:Carmil1 APN 13 24094455 missense probably damaging 0.99
H8562:Carmil1 UTSW 13 24064647 missense probably benign 0.00
R0085:Carmil1 UTSW 13 24025867 missense probably benign
R0119:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0166:Carmil1 UTSW 13 24099049 missense probably damaging 1.00
R0299:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0304:Carmil1 UTSW 13 24139341 missense probably damaging 0.99
R0335:Carmil1 UTSW 13 24073983 missense probably damaging 1.00
R0369:Carmil1 UTSW 13 24082020 missense probably damaging 0.98
R0462:Carmil1 UTSW 13 24022511 missense probably benign 0.01
R1203:Carmil1 UTSW 13 24099006 missense probably damaging 1.00
R1540:Carmil1 UTSW 13 24099054 missense possibly damaging 0.92
R1730:Carmil1 UTSW 13 24041689 missense probably damaging 1.00
R1770:Carmil1 UTSW 13 24173674 missense probably damaging 1.00
R1831:Carmil1 UTSW 13 24164879 missense probably benign 0.00
R1893:Carmil1 UTSW 13 24024463 missense possibly damaging 0.72
R2099:Carmil1 UTSW 13 24173667 missense probably benign 0.00
R2153:Carmil1 UTSW 13 24141673 missense probably damaging 0.97
R2296:Carmil1 UTSW 13 24115509 missense probably damaging 1.00
R2869:Carmil1 UTSW 13 24045068 synonymous silent
R2872:Carmil1 UTSW 13 24045068 synonymous silent
R3113:Carmil1 UTSW 13 24069757 missense probably benign 0.22
R3508:Carmil1 UTSW 13 24019676 utr 3 prime probably benign
R3780:Carmil1 UTSW 13 24137169 missense probably damaging 0.99
R3954:Carmil1 UTSW 13 24013407 missense probably benign 0.00
R4027:Carmil1 UTSW 13 24067223 splice site probably benign
R4086:Carmil1 UTSW 13 24024461 missense possibly damaging 0.56
R4647:Carmil1 UTSW 13 24137179 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24067190 missense probably damaging 1.00
R4792:Carmil1 UTSW 13 24141676 missense possibly damaging 0.96
R5012:Carmil1 UTSW 13 24024420 missense possibly damaging 0.81
R5166:Carmil1 UTSW 13 24154983 critical splice donor site probably null
R5199:Carmil1 UTSW 13 24111870 missense probably damaging 1.00
R5330:Carmil1 UTSW 13 24025946 splice site probably null
R5472:Carmil1 UTSW 13 24155471 missense probably damaging 0.97
R5478:Carmil1 UTSW 13 24112045 missense probably damaging 1.00
R5496:Carmil1 UTSW 13 24155450 missense probably damaging 1.00
R5775:Carmil1 UTSW 13 24276537 missense probably benign
R5789:Carmil1 UTSW 13 24121848 missense probably damaging 1.00
R5794:Carmil1 UTSW 13 24092550 missense probably damaging 1.00
R5977:Carmil1 UTSW 13 24069736 missense probably damaging 1.00
R6128:Carmil1 UTSW 13 24013194 nonsense probably null
R6403:Carmil1 UTSW 13 24081967 missense probably damaging 1.00
R6450:Carmil1 UTSW 13 24036564 missense probably damaging 0.98
R6451:Carmil1 UTSW 13 24092558 nonsense probably null
R6684:Carmil1 UTSW 13 24022542 missense unknown
R6891:Carmil1 UTSW 13 24141723 missense probably benign 0.13
R6902:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R6924:Carmil1 UTSW 13 24075684 nonsense probably null
R6946:Carmil1 UTSW 13 24115545 missense possibly damaging 0.79
R7038:Carmil1 UTSW 13 24139335 missense probably damaging 1.00
R7179:Carmil1 UTSW 13 24020069 missense probably benign 0.00
R7282:Carmil1 UTSW 13 24013404 missense probably benign
R7286:Carmil1 UTSW 13 24013394 missense probably damaging 0.96
R7397:Carmil1 UTSW 13 24044311 missense probably damaging 0.99
R7412:Carmil1 UTSW 13 24098810 missense possibly damaging 0.50
R7611:Carmil1 UTSW 13 24013332 missense probably benign 0.30
R7642:Carmil1 UTSW 13 24067206 missense probably benign 0.12
R7827:Carmil1 UTSW 13 24036438 missense probably benign 0.00
X0025:Carmil1 UTSW 13 24099043 missense possibly damaging 0.47
Z1088:Carmil1 UTSW 13 24044182 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACCTTCTGTGCACATGCTG -3'
(R):5'- AACACTGTCTATGACTTGGCTG -3'

Sequencing Primer
(F):5'- GTGCACATGCTGCCCTC -3'
(R):5'- AGGAGTGGCTTCCTCAACCTG -3'
Posted On2017-10-10