Incidental Mutation 'R6128:Cyp7a1'
ID487494
Institutional Source Beutler Lab
Gene Symbol Cyp7a1
Ensembl Gene ENSMUSG00000028240
Gene Namecytochrome P450, family 7, subfamily a, polypeptide 1
Synonymscholesterol 7 alpha hydroxylase
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location6265612-6275633 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 6272788 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 142 (S142P)
Ref Sequence ENSEMBL: ENSMUSP00000029905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029905
AA Change: S142P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: S142P

DomainStartEndE-ValueType
transmembrane domain 5 24 N/A INTRINSIC
Pfam:p450 32 497 2.3e-87 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147346
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Cyp7a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01298:Cyp7a1 APN 4 6275517 missense probably damaging 1.00
IGL01577:Cyp7a1 APN 4 6273618 missense probably damaging 1.00
IGL01723:Cyp7a1 APN 4 6272442 missense probably damaging 1.00
IGL02602:Cyp7a1 APN 4 6272871 missense possibly damaging 0.88
IGL03302:Cyp7a1 APN 4 6273801 missense probably benign 0.05
R1017:Cyp7a1 UTSW 4 6272307 missense probably damaging 1.00
R1737:Cyp7a1 UTSW 4 6272848 missense probably benign 0.00
R2044:Cyp7a1 UTSW 4 6275492 missense probably null 1.00
R2326:Cyp7a1 UTSW 4 6268396 missense probably benign
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R2867:Cyp7a1 UTSW 4 6272493 missense probably damaging 0.99
R3438:Cyp7a1 UTSW 4 6272769 missense probably damaging 1.00
R4181:Cyp7a1 UTSW 4 6271205 missense probably benign 0.09
R4844:Cyp7a1 UTSW 4 6273655 missense probably damaging 1.00
R5184:Cyp7a1 UTSW 4 6271207 missense probably benign
R5371:Cyp7a1 UTSW 4 6268378 missense probably damaging 1.00
R5613:Cyp7a1 UTSW 4 6272799 missense probably damaging 1.00
R5682:Cyp7a1 UTSW 4 6268429 missense probably benign 0.28
R5987:Cyp7a1 UTSW 4 6268476 missense probably benign 0.05
R5995:Cyp7a1 UTSW 4 6272371 missense possibly damaging 0.74
R6552:Cyp7a1 UTSW 4 6272361 nonsense probably null
R6860:Cyp7a1 UTSW 4 6272587 missense probably damaging 1.00
R7032:Cyp7a1 UTSW 4 6268463 missense possibly damaging 0.94
R7631:Cyp7a1 UTSW 4 6272763 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AGTGCCGGAAATACTTGGTC -3'
(R):5'- TCCTATTAGGGAAGGCCAGG -3'

Sequencing Primer
(F):5'- GTGCCGGAAATACTTGGTCAAATTG -3'
(R):5'- CCAGGCAGAGAAGTATGAATGTATTC -3'
Posted On2017-10-10