Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Cyp7a1'

487494

Institutional Source

Beutler Lab

Gene Symbol

Cyp7a1

Ensembl Gene

ENSMUSG00000028240

Gene Name

cytochrome P450, family 7, subfamily a, polypeptide 1

Synonyms

cholesterol 7 alpha hydroxylase

MMRRC Submission

044275-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.411) question?

Stock #

R6128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

6265612-6275633 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 6272788 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 142 (S142P)

Ref Sequence

ENSEMBL: ENSMUSP00000029905 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029905]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029905
AA Change: S142P

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000029905
Gene: ENSMUSG00000028240
AA Change: S142P

Domain	Start	End	E-Value	Type
transmembrane domain	5	24	N/A	INTRINSIC
Pfam:p450	32	497	2.3e-87	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147346

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum membrane protein catalyzes the first reaction in the cholesterol catabolic pathway in the liver, which converts cholesterol to bile acids. This reaction is the rate limiting step and the major site of regulation of bile acid synthesis, which is the primary mechanism for the removal of cholesterol from the body. Polymorphisms in the promoter of this gene are associated with defects in bile acid synthesis. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for disruption of this gene experience severe neonatal and postnatal lethality. Supplementation of the maternal diet with fat soluble vitamins and cholic acid starting before birth alleviates much of the phenotype. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Asah1	C	T	8: 41,354,055	V111M	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bptf	G	T	11: 107,074,690	A1163D	possibly damaging	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gtf2a1l	T	A	17: 88,694,658	V314E	probably null	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pik3cb	T	C	9: 99,064,099	D558G	possibly damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Cyp7a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01298:Cyp7a1	APN	4	6275517	missense	probably damaging	1.00
IGL01577:Cyp7a1	APN	4	6273618	missense	probably damaging	1.00
IGL01723:Cyp7a1	APN	4	6272442	missense	probably damaging	1.00
IGL02602:Cyp7a1	APN	4	6272871	missense	possibly damaging	0.88
IGL03302:Cyp7a1	APN	4	6273801	missense	probably benign	0.05
R1017:Cyp7a1	UTSW	4	6272307	missense	probably damaging	1.00
R1737:Cyp7a1	UTSW	4	6272848	missense	probably benign	0.00
R2044:Cyp7a1	UTSW	4	6275492	missense	probably null	1.00
R2326:Cyp7a1	UTSW	4	6268396	missense	probably benign
R2867:Cyp7a1	UTSW	4	6272493	missense	probably damaging	0.99
R2867:Cyp7a1	UTSW	4	6272493	missense	probably damaging	0.99
R3438:Cyp7a1	UTSW	4	6272769	missense	probably damaging	1.00
R4181:Cyp7a1	UTSW	4	6271205	missense	probably benign	0.09
R4844:Cyp7a1	UTSW	4	6273655	missense	probably damaging	1.00
R5184:Cyp7a1	UTSW	4	6271207	missense	probably benign
R5371:Cyp7a1	UTSW	4	6268378	missense	probably damaging	1.00
R5613:Cyp7a1	UTSW	4	6272799	missense	probably damaging	1.00
R5682:Cyp7a1	UTSW	4	6268429	missense	probably benign	0.28
R5987:Cyp7a1	UTSW	4	6268476	missense	probably benign	0.05
R5995:Cyp7a1	UTSW	4	6272371	missense	possibly damaging	0.74
R6552:Cyp7a1	UTSW	4	6272361	nonsense	probably null
R6860:Cyp7a1	UTSW	4	6272587	missense	probably damaging	1.00
R7032:Cyp7a1	UTSW	4	6268463	missense	possibly damaging	0.94
R7631:Cyp7a1	UTSW	4	6272763	missense	possibly damaging	0.89
R7884:Cyp7a1	UTSW	4	6272697	missense	probably benign	0.04
R8289:Cyp7a1	UTSW	4	6268295	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTGCCGGAAATACTTGGTC -3'
(R):5'- TCCTATTAGGGAAGGCCAGG -3'

Sequencing Primer
(F):5'- GTGCCGGAAATACTTGGTCAAATTG -3'
(R):5'- CCAGGCAGAGAAGTATGAATGTATTC -3'

Posted On

2017-10-10