Incidental Mutation 'R6128:Ticrr'
ID 487512
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene Name TOPBP1-interacting checkpoint and replication regulator
Synonyms 5730590G19Rik
MMRRC Submission 044275-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.949) question?
Stock # R6128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 79309944-79347896 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 79343716 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Threonine at position 1194 (P1194T)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
AlphaFold Q8BQ33
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: P1194T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: P1194T

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
A430033K04Rik A G 5: 138,646,038 (GRCm39) H641R probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Asah1 C T 8: 41,807,092 (GRCm39) V111M probably damaging Het
Ascc3 T C 10: 50,526,734 (GRCm39) L611P probably damaging Het
Atl2 C A 17: 80,172,470 (GRCm39) probably null Het
Bhlhe22 A T 3: 18,109,987 (GRCm39) S346C probably damaging Het
Bicc1 T C 10: 70,776,313 (GRCm39) probably null Het
Bptf G T 11: 106,965,516 (GRCm39) A1163D possibly damaging Het
Bub1b T A 2: 118,448,293 (GRCm39) C382S probably benign Het
Carmil1 A T 13: 24,197,177 (GRCm39) Y158* probably null Het
Ccdc175 A T 12: 72,175,933 (GRCm39) I473K probably benign Het
Ccdc18 A G 5: 108,311,625 (GRCm39) I444V possibly damaging Het
Cep131 T A 11: 119,956,801 (GRCm39) I880F probably damaging Het
Ces2e T A 8: 105,655,428 (GRCm39) I117N probably benign Het
Clk2 C T 3: 89,081,531 (GRCm39) T289M probably damaging Het
Crocc2 A T 1: 93,122,123 (GRCm39) D672V probably benign Het
Cul7 T A 17: 46,962,588 (GRCm39) I73N probably damaging Het
Cyp2d12 C A 15: 82,443,166 (GRCm39) D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 (GRCm39) S142P possibly damaging Het
Daw1 T A 1: 83,183,647 (GRCm39) C232* probably null Het
Dhx9 T C 1: 153,353,835 (GRCm39) K195R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpp3 A G 19: 4,972,420 (GRCm39) V168A probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ercc6l2 T C 13: 64,001,563 (GRCm39) V459A probably damaging Het
Erp44 A T 4: 48,243,493 (GRCm39) N38K probably damaging Het
Fam135a A G 1: 24,069,821 (GRCm39) probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fdps T C 3: 89,006,740 (GRCm39) E117G possibly damaging Het
Gbp4 A C 5: 105,283,030 (GRCm39) V80G possibly damaging Het
Glt1d1 A T 5: 127,754,335 (GRCm39) D179V probably damaging Het
Gtf2a1l T A 17: 89,002,086 (GRCm39) V314E probably null Het
Gzmf G T 14: 56,443,443 (GRCm39) Y178* probably null Het
Hira C T 16: 18,751,727 (GRCm39) P509S probably benign Het
Ifi44 T C 3: 151,454,823 (GRCm39) N134S probably benign Het
Igfbp2 T A 1: 72,863,958 (GRCm39) C74S probably damaging Het
Il24 A G 1: 130,813,435 (GRCm39) L54P probably damaging Het
Ints10 T C 8: 69,274,904 (GRCm39) probably null Het
Ipo9 A G 1: 135,318,311 (GRCm39) C700R possibly damaging Het
Kalrn T A 16: 34,033,255 (GRCm39) Q469L probably damaging Het
Lrp1b T G 2: 40,750,667 (GRCm39) I2966L probably benign Het
Lta C A 17: 35,422,817 (GRCm39) V169L possibly damaging Het
Lyst T C 13: 13,933,964 (GRCm39) V3554A possibly damaging Het
Mobp A G 9: 119,997,392 (GRCm39) probably benign Het
Myorg T A 4: 41,498,445 (GRCm39) N395I probably damaging Het
Or10d1 C G 9: 39,484,549 (GRCm39) R2T probably benign Het
Or4b1d A T 2: 89,968,954 (GRCm39) C176* probably null Het
Or8c14-ps1 T C 9: 38,101,299 (GRCm39) S93P probably benign Het
Pacs1 A T 19: 5,202,400 (GRCm39) probably null Het
Phf21a G T 2: 92,181,953 (GRCm39) probably null Het
Pick1 T A 15: 79,123,896 (GRCm39) M89K probably damaging Het
Pik3cb T C 9: 98,946,152 (GRCm39) D558G possibly damaging Het
Pnma8a A G 7: 16,694,661 (GRCm39) D172G probably benign Het
Polr2a A C 11: 69,627,803 (GRCm39) V1368G probably damaging Het
Pomt2 A G 12: 87,158,109 (GRCm39) probably null Het
Pou2f1 T C 1: 165,703,056 (GRCm39) probably benign Het
Rnf145 T C 11: 44,446,018 (GRCm39) V284A probably damaging Het
Robo1 A T 16: 72,809,956 (GRCm39) M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr3 C T 2: 112,784,639 (GRCm39) probably null Het
Scamp1 A C 13: 94,344,735 (GRCm39) L202R possibly damaging Het
Snx25 C T 8: 46,558,240 (GRCm39) V110I probably benign Het
Spata31e2 G A 1: 26,724,506 (GRCm39) P225S probably benign Het
Susd6 T A 12: 80,915,388 (GRCm39) H124Q possibly damaging Het
Tarm1 T C 7: 3,537,720 (GRCm39) T248A probably benign Het
Tc2n A G 12: 101,675,748 (GRCm39) M1T probably null Het
Tcerg1 C A 18: 42,644,563 (GRCm39) probably null Het
Trim31 T G 17: 37,220,491 (GRCm39) V469G probably benign Het
Vcp T C 4: 42,980,941 (GRCm39) E723G probably benign Het
Vmn1r177 C A 7: 23,565,267 (GRCm39) S203I probably damaging Het
Vmn1r177 T A 7: 23,565,268 (GRCm39) S203C probably damaging Het
Vmn1r210 A T 13: 23,012,277 (GRCm39) L3* probably null Het
Wdr27 T A 17: 15,152,796 (GRCm39) R104* probably null Het
Wnk1 A C 6: 119,940,747 (GRCm39) probably null Het
Zfp157 A G 5: 138,453,281 (GRCm39) E88G possibly damaging Het
Zfp708 A T 13: 67,222,965 (GRCm39) L22Q probably damaging Het
Zfp788 T C 7: 41,299,785 (GRCm39) F787S probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79,327,031 (GRCm39) missense probably damaging 1.00
IGL00596:Ticrr APN 7 79,327,041 (GRCm39) missense probably damaging 1.00
IGL01327:Ticrr APN 7 79,344,209 (GRCm39) missense probably benign 0.00
IGL01525:Ticrr APN 7 79,332,197 (GRCm39) missense probably damaging 1.00
IGL01565:Ticrr APN 7 79,344,296 (GRCm39) missense probably benign
IGL01936:Ticrr APN 7 79,344,297 (GRCm39) missense probably benign 0.11
IGL02160:Ticrr APN 7 79,343,767 (GRCm39) missense probably benign 0.29
IGL02246:Ticrr APN 7 79,325,076 (GRCm39) missense probably damaging 1.00
IGL02487:Ticrr APN 7 79,332,769 (GRCm39) missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79,345,214 (GRCm39) missense probably damaging 0.99
IGL02970:Ticrr APN 7 79,344,919 (GRCm39) missense probably benign 0.01
FR4304:Ticrr UTSW 7 79,344,059 (GRCm39) intron probably benign
PIT4305001:Ticrr UTSW 7 79,328,771 (GRCm39) missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79,319,386 (GRCm39) missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79,343,540 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0062:Ticrr UTSW 7 79,317,654 (GRCm39) missense probably benign 0.01
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0067:Ticrr UTSW 7 79,327,158 (GRCm39) missense probably damaging 1.00
R0362:Ticrr UTSW 7 79,327,088 (GRCm39) missense probably damaging 1.00
R0482:Ticrr UTSW 7 79,344,236 (GRCm39) missense probably damaging 0.99
R0595:Ticrr UTSW 7 79,345,311 (GRCm39) missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1119:Ticrr UTSW 7 79,343,701 (GRCm39) missense probably benign 0.23
R1572:Ticrr UTSW 7 79,331,572 (GRCm39) missense probably damaging 1.00
R1658:Ticrr UTSW 7 79,345,297 (GRCm39) missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79,328,794 (GRCm39) nonsense probably null
R1757:Ticrr UTSW 7 79,325,071 (GRCm39) missense probably damaging 0.99
R1862:Ticrr UTSW 7 79,344,955 (GRCm39) missense probably damaging 1.00
R1869:Ticrr UTSW 7 79,328,883 (GRCm39) missense probably damaging 1.00
R1938:Ticrr UTSW 7 79,325,142 (GRCm39) missense probably damaging 0.98
R1966:Ticrr UTSW 7 79,344,483 (GRCm39) nonsense probably null
R2006:Ticrr UTSW 7 79,343,821 (GRCm39) missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79,315,433 (GRCm39) missense probably benign 0.12
R3404:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3405:Ticrr UTSW 7 79,344,539 (GRCm39) missense probably benign 0.06
R3941:Ticrr UTSW 7 79,343,445 (GRCm39) intron probably benign
R3950:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3951:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R3952:Ticrr UTSW 7 79,331,817 (GRCm39) missense probably damaging 1.00
R4967:Ticrr UTSW 7 79,310,158 (GRCm39) missense probably damaging 0.99
R4972:Ticrr UTSW 7 79,319,416 (GRCm39) missense probably damaging 0.98
R5259:Ticrr UTSW 7 79,344,471 (GRCm39) missense probably benign 0.01
R5272:Ticrr UTSW 7 79,319,353 (GRCm39) missense probably benign 0.44
R5374:Ticrr UTSW 7 79,340,690 (GRCm39) nonsense probably null
R5480:Ticrr UTSW 7 79,310,557 (GRCm39) missense probably damaging 1.00
R5568:Ticrr UTSW 7 79,345,044 (GRCm39) nonsense probably null
R5568:Ticrr UTSW 7 79,339,715 (GRCm39) critical splice donor site probably null
R5588:Ticrr UTSW 7 79,328,853 (GRCm39) missense probably damaging 1.00
R5698:Ticrr UTSW 7 79,328,881 (GRCm39) missense probably benign
R5879:Ticrr UTSW 7 79,346,438 (GRCm39) missense probably benign 0.12
R5980:Ticrr UTSW 7 79,310,703 (GRCm39) missense probably damaging 0.99
R6277:Ticrr UTSW 7 79,344,444 (GRCm39) missense probably benign 0.00
R6335:Ticrr UTSW 7 79,344,031 (GRCm39) splice site probably null
R6866:Ticrr UTSW 7 79,343,705 (GRCm39) missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79,315,598 (GRCm39) missense probably benign 0.00
R6923:Ticrr UTSW 7 79,341,601 (GRCm39) missense probably damaging 0.98
R6962:Ticrr UTSW 7 79,315,645 (GRCm39) missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79,343,490 (GRCm39) missense probably damaging 0.96
R7285:Ticrr UTSW 7 79,310,610 (GRCm39) missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79,341,597 (GRCm39) missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79,343,734 (GRCm39) missense probably benign
R7583:Ticrr UTSW 7 79,346,487 (GRCm39) nonsense probably null
R7749:Ticrr UTSW 7 79,328,844 (GRCm39) missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79,331,760 (GRCm39) missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79,319,233 (GRCm39) missense probably benign 0.23
R7935:Ticrr UTSW 7 79,331,584 (GRCm39) missense probably damaging 0.99
R8005:Ticrr UTSW 7 79,343,796 (GRCm39) missense probably damaging 0.98
R8080:Ticrr UTSW 7 79,334,012 (GRCm39) splice site probably null
R8181:Ticrr UTSW 7 79,310,728 (GRCm39) missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R8410:Ticrr UTSW 7 79,317,423 (GRCm39) missense probably damaging 0.98
R8449:Ticrr UTSW 7 79,344,428 (GRCm39) missense probably benign 0.27
R9073:Ticrr UTSW 7 79,317,679 (GRCm39) missense probably benign 0.01
R9090:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9271:Ticrr UTSW 7 79,310,604 (GRCm39) missense possibly damaging 0.85
R9287:Ticrr UTSW 7 79,343,516 (GRCm39) missense possibly damaging 0.89
R9368:Ticrr UTSW 7 79,330,735 (GRCm39) missense probably damaging 0.99
R9469:Ticrr UTSW 7 79,344,511 (GRCm39) missense probably benign 0.03
R9502:Ticrr UTSW 7 79,343,597 (GRCm39) missense probably benign
R9614:Ticrr UTSW 7 79,345,754 (GRCm39) missense probably damaging 1.00
R9761:Ticrr UTSW 7 79,345,313 (GRCm39) missense probably damaging 1.00
R9779:Ticrr UTSW 7 79,328,802 (GRCm39) missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- TCGTACAGCACAGACCTTACTATAC -3'
(R):5'- TGCTTAGACGTGCCAGCAAG -3'

Sequencing Primer
(F):5'- GCACAGACCTTACTATACACTCCAG -3'
(R):5'- GCAAGGGCTGTACGTGG -3'
Posted On 2017-10-10