Incidental Mutation 'R6128:Ticrr'
ID487512
Institutional Source Beutler Lab
Gene Symbol Ticrr
Ensembl Gene ENSMUSG00000046591
Gene NameTOPBP1-interacting checkpoint and replication regulator
Synonyms5730590G19Rik
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location79660196-79698148 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 79693968 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 1194 (P1194T)
Ref Sequence ENSEMBL: ENSMUSP00000041377 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000059836] [ENSMUST00000178048] [ENSMUST00000183846] [ENSMUST00000184137] [ENSMUST00000206591] [ENSMUST00000206622]
Predicted Effect probably damaging
Transcript: ENSMUST00000035977
AA Change: P1194T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: P1194T

DomainStartEndE-ValueType
low complexity region 23 31 N/A INTRINSIC
Pfam:Treslin_N 211 1005 N/A PFAM
low complexity region 1186 1197 N/A INTRINSIC
low complexity region 1220 1235 N/A INTRINSIC
low complexity region 1339 1359 N/A INTRINSIC
low complexity region 1472 1480 N/A INTRINSIC
low complexity region 1496 1514 N/A INTRINSIC
low complexity region 1630 1643 N/A INTRINSIC
low complexity region 1694 1707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000059836
SMART Domains Protein: ENSMUSP00000061806
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178048
SMART Domains Protein: ENSMUSP00000136993
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183846
SMART Domains Protein: ENSMUSP00000139359
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 908 918 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
low complexity region 980 994 N/A INTRINSIC
low complexity region 1050 1062 N/A INTRINSIC
coiled coil region 1114 1140 N/A INTRINSIC
coiled coil region 1187 1206 N/A INTRINSIC
low complexity region 1294 1305 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184137
SMART Domains Protein: ENSMUSP00000139224
Gene: ENSMUSG00000050382

DomainStartEndE-ValueType
KISc 13 357 2.88e-143 SMART
low complexity region 391 410 N/A INTRINSIC
Blast:KISc 413 481 1e-19 BLAST
Blast:KISc 482 518 3e-11 BLAST
low complexity region 523 540 N/A INTRINSIC
low complexity region 543 557 N/A INTRINSIC
low complexity region 621 636 N/A INTRINSIC
low complexity region 669 685 N/A INTRINSIC
Blast:KISc 780 879 2e-15 BLAST
low complexity region 927 944 N/A INTRINSIC
low complexity region 979 993 N/A INTRINSIC
low complexity region 1049 1061 N/A INTRINSIC
coiled coil region 1113 1139 N/A INTRINSIC
coiled coil region 1186 1205 N/A INTRINSIC
low complexity region 1293 1304 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206591
Predicted Effect probably benign
Transcript: ENSMUST00000206622
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Ticrr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Ticrr APN 7 79677283 missense probably damaging 1.00
IGL00596:Ticrr APN 7 79677293 missense probably damaging 1.00
IGL01327:Ticrr APN 7 79694461 missense probably benign 0.00
IGL01525:Ticrr APN 7 79682449 missense probably damaging 1.00
IGL01565:Ticrr APN 7 79694548 missense probably benign
IGL01936:Ticrr APN 7 79694549 missense probably benign 0.11
IGL02160:Ticrr APN 7 79694019 missense probably benign 0.29
IGL02246:Ticrr APN 7 79675328 missense probably damaging 1.00
IGL02487:Ticrr APN 7 79683021 missense possibly damaging 0.86
IGL02593:Ticrr APN 7 79695466 missense probably damaging 0.99
IGL02970:Ticrr APN 7 79695171 missense probably benign 0.01
FR4304:Ticrr UTSW 7 79694311 intron probably benign
PIT4305001:Ticrr UTSW 7 79679023 missense possibly damaging 0.95
PIT4791001:Ticrr UTSW 7 79669638 missense possibly damaging 0.92
R0016:Ticrr UTSW 7 79693792 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0062:Ticrr UTSW 7 79667906 missense probably benign 0.01
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0067:Ticrr UTSW 7 79677410 missense probably damaging 1.00
R0362:Ticrr UTSW 7 79677340 missense probably damaging 1.00
R0482:Ticrr UTSW 7 79694488 missense probably damaging 0.99
R0595:Ticrr UTSW 7 79695563 missense possibly damaging 0.94
R1118:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1119:Ticrr UTSW 7 79693953 missense probably benign 0.23
R1572:Ticrr UTSW 7 79681824 missense probably damaging 1.00
R1658:Ticrr UTSW 7 79695549 missense possibly damaging 0.57
R1757:Ticrr UTSW 7 79675323 missense probably damaging 0.99
R1757:Ticrr UTSW 7 79679046 nonsense probably null
R1862:Ticrr UTSW 7 79695207 missense probably damaging 1.00
R1869:Ticrr UTSW 7 79679135 missense probably damaging 1.00
R1938:Ticrr UTSW 7 79675394 missense probably damaging 0.98
R1966:Ticrr UTSW 7 79694735 nonsense probably null
R2006:Ticrr UTSW 7 79694073 missense possibly damaging 0.93
R2178:Ticrr UTSW 7 79665685 missense probably benign 0.12
R3404:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3405:Ticrr UTSW 7 79694791 missense probably benign 0.06
R3941:Ticrr UTSW 7 79693697 intron probably benign
R3950:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3951:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R3952:Ticrr UTSW 7 79682069 missense probably damaging 1.00
R4967:Ticrr UTSW 7 79660410 missense probably damaging 0.99
R4972:Ticrr UTSW 7 79669668 missense probably damaging 0.98
R5259:Ticrr UTSW 7 79694723 missense probably benign 0.01
R5272:Ticrr UTSW 7 79669605 missense probably benign 0.44
R5374:Ticrr UTSW 7 79690942 nonsense probably null
R5480:Ticrr UTSW 7 79660809 missense probably damaging 1.00
R5568:Ticrr UTSW 7 79689967 critical splice donor site probably null
R5568:Ticrr UTSW 7 79695296 nonsense probably null
R5588:Ticrr UTSW 7 79679105 missense probably damaging 1.00
R5698:Ticrr UTSW 7 79679133 missense probably benign
R5879:Ticrr UTSW 7 79696690 missense probably benign 0.12
R5980:Ticrr UTSW 7 79660955 missense probably damaging 0.99
R6277:Ticrr UTSW 7 79694696 missense probably benign 0.00
R6335:Ticrr UTSW 7 79694283 splice site probably null
R6866:Ticrr UTSW 7 79693957 missense possibly damaging 0.47
R6905:Ticrr UTSW 7 79665850 missense probably benign 0.00
R6923:Ticrr UTSW 7 79691853 missense probably damaging 0.98
R6962:Ticrr UTSW 7 79665897 missense possibly damaging 0.84
R7232:Ticrr UTSW 7 79693742 missense probably damaging 0.96
R7285:Ticrr UTSW 7 79660862 missense possibly damaging 0.93
R7385:Ticrr UTSW 7 79691849 missense possibly damaging 0.93
R7426:Ticrr UTSW 7 79693986 missense probably benign
R7583:Ticrr UTSW 7 79696739 nonsense probably null
R7749:Ticrr UTSW 7 79679096 missense possibly damaging 0.94
R7863:Ticrr UTSW 7 79682012 missense possibly damaging 0.92
R7899:Ticrr UTSW 7 79669485 missense probably benign 0.23
R7935:Ticrr UTSW 7 79681836 missense probably damaging 0.99
R8005:Ticrr UTSW 7 79694048 missense probably damaging 0.98
R8080:Ticrr UTSW 7 79684264 splice site probably null
R8181:Ticrr UTSW 7 79660980 missense possibly damaging 0.92
R8349:Ticrr UTSW 7 79694680 missense probably benign 0.27
R8410:Ticrr UTSW 7 79667675 missense probably damaging 0.98
R8449:Ticrr UTSW 7 79694680 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCGTACAGCACAGACCTTACTATAC -3'
(R):5'- TGCTTAGACGTGCCAGCAAG -3'

Sequencing Primer
(F):5'- GCACAGACCTTACTATACACTCCAG -3'
(R):5'- GCAAGGGCTGTACGTGG -3'
Posted On2017-10-10