Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Asah1'

487514

Institutional Source

Beutler Lab

Gene Symbol

Asah1

Ensembl Gene

ENSMUSG00000031591

Gene Name

N-acylsphingosine amidohydrolase 1

Synonyms

acid ceramidase, 2310081N20Rik

MMRRC Submission

044275-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

41340197-41374773 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 41354055 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 111 (V111M)

Ref Sequence

ENSEMBL: ENSMUSP00000117362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034000] [ENSMUST00000110417] [ENSMUST00000143057]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000034000
AA Change: V87M

PolyPhen 2 Score 0.936 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000034000
Gene: ENSMUSG00000031591
AA Change: V87M

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
Pfam:NAAA-beta	44	138	4.2e-35	PFAM
Pfam:CBAH	142	389	1e-58	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000110417

SMART Domains

Protein: ENSMUSP00000106047
Gene: ENSMUSG00000031591

Domain	Start	End	E-Value	Type
Pfam:NAAA-beta	24	118	8.8e-39	PFAM
Pfam:CBAH	122	216	7.9e-24	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126561

Predicted Effect

probably damaging
Transcript: ENSMUST00000143057
AA Change: V111M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000117362
Gene: ENSMUSG00000031591
AA Change: V111M

Domain	Start	End	E-Value	Type
signal peptide	1	26	N/A	INTRINSIC
Pfam:NAAA-beta	68	120	6.4e-18	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes acid ceramidase, an enzyme that plays a central role in ceramide metabolism. The encoded protein undergoes proteolytic processing to generate a heterodimeric enzyme comprised of alpha and beta subunits that catalyzes the hydrolysis of sphingolipid ceramide into sphingosine and free fatty acid. The homozygous disruption of this gene leads to embryonic lethality in mice whereas the heterozygous animals exhibit a progressive lipid storage disease phenotype. [provided by RefSeq, Oct 2015]
PHENOTYPE: Nullizygous mutation of this gene causes embryonic lethality. Homozygotes for the P361R mutation die prematurely with growth defects, low acid ceramidase activity, high ceramide levels, histiocyte infiltrates into various organs, Farber bodies, short femur growth plates and altered ovary morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bptf	G	T	11: 107,074,690	A1163D	possibly damaging	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Cyp7a1	A	G	4: 6,272,788	S142P	possibly damaging	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gtf2a1l	T	A	17: 88,694,658	V314E	probably null	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pik3cb	T	C	9: 99,064,099	D558G	possibly damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Asah1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01824:Asah1	APN	8	41349543	unclassified	probably benign
IGL02512:Asah1	APN	8	41360307	intron	probably benign
IGL02523:Asah1	APN	8	41351947	missense	probably benign
IGL03115:Asah1	APN	8	41360299	missense	possibly damaging	0.94
IGL03357:Asah1	APN	8	41346196	splice site	probably benign
PIT4366001:Asah1	UTSW	8	41343746	missense	possibly damaging	0.94
R0593:Asah1	UTSW	8	41349582	missense	probably benign	0.02
R1451:Asah1	UTSW	8	41354012	critical splice donor site	probably null
R1977:Asah1	UTSW	8	41343517	critical splice donor site	probably null
R2200:Asah1	UTSW	8	41343728	critical splice donor site	probably null
R3429:Asah1	UTSW	8	41351888	unclassified	probably benign
R4002:Asah1	UTSW	8	41348139	splice site	probably benign
R4078:Asah1	UTSW	8	41354082	missense	probably damaging	0.99
R4470:Asah1	UTSW	8	41343724	splice site	probably null
R4471:Asah1	UTSW	8	41343724	splice site	probably null
R4968:Asah1	UTSW	8	41354030	missense
R4970:Asah1	UTSW	8	41360277	nonsense	probably null
R5643:Asah1	UTSW	8	41360295	missense	possibly damaging	0.94
R5644:Asah1	UTSW	8	41360295	missense	possibly damaging	0.94
R6419:Asah1	UTSW	8	41343766	missense	probably damaging	1.00
R7059:Asah1	UTSW	8	41347069	missense	probably damaging	0.96
R7442:Asah1	UTSW	8	41343565	missense	possibly damaging	0.60
R7587:Asah1	UTSW	8	41374541	missense	probably benign	0.43
R7663:Asah1	UTSW	8	41341627	missense	probably damaging	0.98
R7980:Asah1	UTSW	8	41354030	missense
R8122:Asah1	UTSW	8	41343730	missense	probably benign	0.01
R8275:Asah1	UTSW	8	41348122	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CATTGCTGTGAGAACTAGGGG -3'
(R):5'- CTGAATGATTGAGAAGCAATGCTAC -3'

Sequencing Primer
(F):5'- CATTGCTGTGAGAACTAGGGGTAGAC -3'
(R):5'- GATTGAGAAGCAATGCTACTTTAAAG -3'

Posted On

2017-10-10