Incidental Mutation 'R0523:BC051142'
ID48752
Institutional Source Beutler Lab
Gene Symbol BC051142
Ensembl Gene ENSMUSG00000057246
Gene NamecDNA sequence BC051142
Synonyms
MMRRC Submission 038716-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.391) question?
Stock #R0523 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location34398820-34460734 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to T at 34445499 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000153432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078615] [ENSMUST00000078615] [ENSMUST00000078615] [ENSMUST00000097348] [ENSMUST00000097348] [ENSMUST00000097348] [ENSMUST00000114175] [ENSMUST00000114175] [ENSMUST00000114175] [ENSMUST00000139063] [ENSMUST00000139063] [ENSMUST00000139063] [ENSMUST00000223957] [ENSMUST00000223957] [ENSMUST00000223957]
Predicted Effect probably null
Transcript: ENSMUST00000078615
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078615
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000078615
SMART Domains Protein: ENSMUSP00000077685
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 144 167 N/A INTRINSIC
low complexity region 246 272 N/A INTRINSIC
low complexity region 328 338 N/A INTRINSIC
low complexity region 364 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097348
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097348
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000097348
SMART Domains Protein: ENSMUSP00000094961
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 151 174 N/A INTRINSIC
low complexity region 253 279 N/A INTRINSIC
low complexity region 335 345 N/A INTRINSIC
low complexity region 371 398 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000114175
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114175
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000114175
SMART Domains Protein: ENSMUSP00000109812
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
low complexity region 142 165 N/A INTRINSIC
SCOP:d1i7qa_ 227 277 5e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000139063
SMART Domains Protein: ENSMUSP00000121839
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139063
SMART Domains Protein: ENSMUSP00000121839
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139063
SMART Domains Protein: ENSMUSP00000121839
Gene: ENSMUSG00000057246

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000223765
Predicted Effect probably null
Transcript: ENSMUST00000223765
Predicted Effect probably null
Transcript: ENSMUST00000223765
Predicted Effect probably null
Transcript: ENSMUST00000223957
Predicted Effect probably null
Transcript: ENSMUST00000223957
Predicted Effect probably null
Transcript: ENSMUST00000223957
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010300C02Rik A T 1: 37,644,629 M1K probably null Het
2410089E03Rik T A 15: 8,194,386 Y878N probably damaging Het
A2ml1 T C 6: 128,558,326 D807G possibly damaging Het
Actl9 T A 17: 33,433,349 W128R probably damaging Het
Aggf1 T C 13: 95,356,416 I562V probably damaging Het
Ano3 T A 2: 110,884,855 E79D probably benign Het
Apobec1 T A 6: 122,581,545 I84F probably damaging Het
Atp6v1b2 T C 8: 69,109,985 F458L possibly damaging Het
Bco2 A T 9: 50,534,626 V490E probably damaging Het
Catsperg1 G A 7: 29,185,190 probably benign Het
Cdc37 T C 9: 21,142,996 K111R probably damaging Het
Cfap54 T C 10: 92,908,883 probably benign Het
Cpox T A 16: 58,675,245 C308* probably null Het
Ctnna3 T G 10: 64,675,909 M626R probably damaging Het
Cyp2c68 T C 19: 39,739,429 E93G probably benign Het
Cyp2s1 G A 7: 25,806,050 R330W probably damaging Het
Diaph1 C T 18: 37,856,500 V860I possibly damaging Het
Dicer1 A G 12: 104,702,491 S1311P probably damaging Het
Dpyd G A 3: 118,899,203 R332K probably benign Het
E130308A19Rik G A 4: 59,719,716 R416H probably damaging Het
Eef1d T C 15: 75,903,156 D218G probably benign Het
Eif2ak1 T C 5: 143,882,166 V215A probably damaging Het
Eif2ak4 T C 2: 118,442,096 probably null Het
Fam71e2 A G 7: 4,759,393 S246P possibly damaging Het
Fcrl5 T C 3: 87,457,792 S583P possibly damaging Het
Grid2ip C A 5: 143,373,043 Q29K possibly damaging Het
Htr1f A T 16: 64,925,899 N343K probably damaging Het
Hvcn1 T C 5: 122,216,365 probably null Het
Igf2r T C 17: 12,692,064 I1956V probably benign Het
Impdh2 A T 9: 108,561,819 probably null Het
Impdh2 C T 9: 108,561,820 T96I possibly damaging Het
Lactb C G 9: 66,970,692 G285A probably benign Het
Lrrc43 T C 5: 123,501,242 S445P probably damaging Het
Maats1 G A 16: 38,328,374 P231S probably damaging Het
Mapk12 T G 15: 89,135,645 M120L probably benign Het
Mroh8 C G 2: 157,224,036 A669P probably damaging Het
Mrpl38 A C 11: 116,132,018 H373Q probably benign Het
Myocd A G 11: 65,180,902 V740A probably damaging Het
Naprt A G 15: 75,892,465 F300S probably damaging Het
Ncam2 T C 16: 81,461,643 I271T probably damaging Het
Nek4 A G 14: 30,980,038 T582A probably benign Het
Notch2 C T 3: 98,070,970 T89I probably benign Het
Notch2 G A 3: 98,111,598 R692H probably benign Het
Nt5c3 A T 6: 56,883,681 N296K probably damaging Het
Nt5c3b T A 11: 100,436,210 I87F probably damaging Het
Oas3 T C 5: 120,766,144 Q555R unknown Het
Olfr1013 T A 2: 85,769,929 S43T probably benign Het
Olfr494 A T 7: 108,368,231 H247L probably damaging Het
Olfr699 A G 7: 106,790,326 V225A probably damaging Het
P3h1 C A 4: 119,241,530 Q410K probably benign Het
Pax3 A G 1: 78,195,441 V44A possibly damaging Het
Pde1c T A 6: 56,174,941 L252F probably damaging Het
Pdzd7 T A 19: 45,036,090 T497S probably benign Het
Piezo2 T C 18: 63,022,481 T253A probably damaging Het
Pipox T C 11: 77,892,139 E79G probably damaging Het
Pole G T 5: 110,303,593 M829I probably damaging Het
Ppp1r12c A T 7: 4,489,772 L156Q probably damaging Het
Psme2b T G 11: 48,945,782 T113P probably damaging Het
Ptprq A G 10: 107,580,220 I1739T possibly damaging Het
Qser1 T C 2: 104,789,676 T174A probably damaging Het
Rcor3 T G 1: 192,130,436 D81A probably damaging Het
Rev3l T C 10: 39,848,049 V785A probably benign Het
Rnf11 T C 4: 109,456,922 D90G probably benign Het
Sh3tc1 GCCTCCTCCTCCTCCTCC GCCTCCTCCTCCTCC 5: 35,724,066 probably benign Het
Smad2 T A 18: 76,262,552 S21T probably benign Het
Smc4 A G 3: 69,025,888 D639G probably damaging Het
Smtn A T 11: 3,524,664 S716T possibly damaging Het
Smug1 G T 15: 103,155,709 Q262K probably benign Het
Sspo G T 6: 48,451,860 G403V probably benign Het
Tas2r131 A G 6: 132,957,451 F132L possibly damaging Het
Tgm3 T C 2: 130,044,662 probably null Het
Tigd2 C T 6: 59,210,373 T75M probably benign Het
Tnfrsf13b T C 11: 61,147,587 V232A probably benign Het
Tnfrsf21 C T 17: 43,038,213 H239Y probably benign Het
Trim47 A G 11: 116,107,890 L301S probably damaging Het
Trim75 G A 8: 64,983,790 H3Y probably benign Het
Trp53bp1 C A 2: 121,251,868 A317S probably null Het
Ttc29 G C 8: 78,276,837 L227F probably benign Het
Ttc39d G A 17: 80,216,457 D182N possibly damaging Het
Ttll10 T A 4: 156,045,361 R164* probably null Het
Ufsp2 T A 8: 45,996,743 D447E probably benign Het
Ugt2b37 T A 5: 87,251,832 L272F possibly damaging Het
Vps13b T C 15: 35,472,050 V833A probably benign Het
Zbbx T C 3: 75,081,858 T308A probably benign Het
Zfp933 G A 4: 147,826,462 Q226* probably null Het
Other mutations in BC051142
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00668:BC051142 APN 17 34420420 unclassified probably benign
IGL01516:BC051142 APN 17 34449260 missense possibly damaging 0.90
FR4304:BC051142 UTSW 17 34460055 unclassified probably benign
FR4304:BC051142 UTSW 17 34460077 unclassified probably benign
FR4340:BC051142 UTSW 17 34460060 nonsense probably null
FR4340:BC051142 UTSW 17 34460068 unclassified probably benign
FR4340:BC051142 UTSW 17 34460077 unclassified probably benign
FR4548:BC051142 UTSW 17 34460065 unclassified probably benign
FR4589:BC051142 UTSW 17 34460053 unclassified probably benign
FR4589:BC051142 UTSW 17 34460073 unclassified probably benign
FR4737:BC051142 UTSW 17 34460051 unclassified probably benign
FR4737:BC051142 UTSW 17 34460068 unclassified probably benign
FR4976:BC051142 UTSW 17 34460058 unclassified probably benign
FR4976:BC051142 UTSW 17 34460061 unclassified probably benign
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0046:BC051142 UTSW 17 34460121 critical splice donor site probably null
R0661:BC051142 UTSW 17 34459913 missense possibly damaging 0.90
R2224:BC051142 UTSW 17 34448763 splice site probably null
R2937:BC051142 UTSW 17 34421862 missense possibly damaging 0.92
R3932:BC051142 UTSW 17 34443443 missense possibly damaging 0.94
R4210:BC051142 UTSW 17 34460283 unclassified probably benign
R4924:BC051142 UTSW 17 34459977 missense probably damaging 0.96
R5055:BC051142 UTSW 17 34448796 missense possibly damaging 0.83
R5446:BC051142 UTSW 17 34440893 splice site probably null
R6147:BC051142 UTSW 17 34418923 missense possibly damaging 0.95
R6851:BC051142 UTSW 17 34460172 missense possibly damaging 0.66
R6866:BC051142 UTSW 17 34459961 missense possibly damaging 0.66
R7035:BC051142 UTSW 17 34460331 unclassified probably benign
R7077:BC051142 UTSW 17 34440882 missense possibly damaging 0.82
R7468:BC051142 UTSW 17 34417565 intron probably null
R7556:BC051142 UTSW 17 34437717 missense unknown
R7843:BC051142 UTSW 17 34449824 missense possibly damaging 0.92
R7926:BC051142 UTSW 17 34449824 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GCTGCTGACAACACAGTCCCTTTC -3'
(R):5'- GTGTGACAAGCTCTCATGTAGCCC -3'

Sequencing Primer
(F):5'- TTCCTACCCAGGCCAGC -3'
(R):5'- tgacctatgacccttgattttcc -3'
Posted On2013-06-12