Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Bptf'

487526

Institutional Source

Beutler Lab

Gene Symbol

Bptf

Ensembl Gene

ENSMUSG00000040481

Gene Name

bromodomain PHD finger transcription factor

Synonyms

9430093H17Rik, Falz

MMRRC Submission

044275-MU

Accession Numbers

Genbank: NM_176850; MGI: 2444008

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107033081-107132127 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 107074690 bp

Zygosity

Heterozygous

Amino Acid Change

Alanine to Aspartic acid at position 1163 (A1163D)

Ref Sequence

ENSEMBL: ENSMUSP00000102373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]

Predicted Effect

probably benign
Transcript: ENSMUST00000057892
AA Change: A1111D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: A1111D

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
coiled coil region	864	894	N/A	INTRINSIC
low complexity region	961	973	N/A	INTRINSIC
low complexity region	987	998	N/A	INTRINSIC
low complexity region	1062	1072	N/A	INTRINSIC
low complexity region	1086	1098	N/A	INTRINSIC
low complexity region	1225	1238	N/A	INTRINSIC
low complexity region	1251	1265	N/A	INTRINSIC
low complexity region	1491	1503	N/A	INTRINSIC
low complexity region	1594	1613	N/A	INTRINSIC
low complexity region	1636	1645	N/A	INTRINSIC
low complexity region	1665	1683	N/A	INTRINSIC
low complexity region	1818	1834	N/A	INTRINSIC
coiled coil region	1908	1936	N/A	INTRINSIC
low complexity region	1941	1957	N/A	INTRINSIC
low complexity region	2051	2061	N/A	INTRINSIC
low complexity region	2092	2107	N/A	INTRINSIC
low complexity region	2115	2128	N/A	INTRINSIC
low complexity region	2175	2197	N/A	INTRINSIC
low complexity region	2227	2252	N/A	INTRINSIC
low complexity region	2275	2312	N/A	INTRINSIC
low complexity region	2336	2355	N/A	INTRINSIC
low complexity region	2361	2378	N/A	INTRINSIC
low complexity region	2390	2420	N/A	INTRINSIC
low complexity region	2430	2463	N/A	INTRINSIC
coiled coil region	2489	2527	N/A	INTRINSIC
coiled coil region	2576	2604	N/A	INTRINSIC
low complexity region	2663	2700	N/A	INTRINSIC
low complexity region	2713	2736	N/A	INTRINSIC
PHD	2744	2791	5.32e-9	SMART
BROMO	2800	2908	5.5e-37	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000106762
AA Change: A1163D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: A1163D

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.7e-8	PFAM
PHD	404	447	2.23e-11	SMART
internal_repeat_1	589	642	6.48e-5	PROSPERO
low complexity region	644	654	N/A	INTRINSIC
low complexity region	662	679	N/A	INTRINSIC
coiled coil region	926	956	N/A	INTRINSIC
low complexity region	1013	1025	N/A	INTRINSIC
low complexity region	1039	1050	N/A	INTRINSIC
low complexity region	1114	1124	N/A	INTRINSIC
low complexity region	1138	1150	N/A	INTRINSIC
low complexity region	1277	1290	N/A	INTRINSIC
low complexity region	1303	1317	N/A	INTRINSIC
internal_repeat_1	1387	1440	6.48e-5	PROSPERO
low complexity region	1543	1555	N/A	INTRINSIC
low complexity region	1646	1665	N/A	INTRINSIC
low complexity region	1688	1697	N/A	INTRINSIC
low complexity region	1717	1735	N/A	INTRINSIC
low complexity region	1870	1886	N/A	INTRINSIC
coiled coil region	1960	1988	N/A	INTRINSIC
low complexity region	1993	2009	N/A	INTRINSIC
low complexity region	2103	2113	N/A	INTRINSIC
low complexity region	2144	2159	N/A	INTRINSIC
low complexity region	2167	2180	N/A	INTRINSIC
low complexity region	2227	2249	N/A	INTRINSIC
low complexity region	2279	2304	N/A	INTRINSIC
low complexity region	2327	2364	N/A	INTRINSIC
low complexity region	2388	2407	N/A	INTRINSIC
low complexity region	2413	2430	N/A	INTRINSIC
low complexity region	2442	2472	N/A	INTRINSIC
low complexity region	2482	2515	N/A	INTRINSIC
coiled coil region	2541	2579	N/A	INTRINSIC
coiled coil region	2628	2656	N/A	INTRINSIC
low complexity region	2715	2752	N/A	INTRINSIC
low complexity region	2765	2788	N/A	INTRINSIC
PHD	2796	2843	5.32e-9	SMART
BROMO	2852	2960	5.5e-37	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000106763
AA Change: A1226D

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: A1226D

Domain	Start	End	E-Value	Type
low complexity region	12	44	N/A	INTRINSIC
low complexity region	49	62	N/A	INTRINSIC
low complexity region	77	119	N/A	INTRINSIC
low complexity region	137	197	N/A	INTRINSIC
low complexity region	202	215	N/A	INTRINSIC
DDT	252	312	2.02e-23	SMART
Pfam:WHIM1	351	400	4.9e-8	PFAM
PHD	404	447	2.23e-11	SMART
low complexity region	624	639	N/A	INTRINSIC
low complexity region	707	717	N/A	INTRINSIC
low complexity region	725	742	N/A	INTRINSIC
coiled coil region	989	1019	N/A	INTRINSIC
low complexity region	1076	1088	N/A	INTRINSIC
low complexity region	1102	1113	N/A	INTRINSIC
low complexity region	1177	1187	N/A	INTRINSIC
low complexity region	1201	1213	N/A	INTRINSIC
low complexity region	1340	1353	N/A	INTRINSIC
low complexity region	1366	1380	N/A	INTRINSIC
low complexity region	1606	1618	N/A	INTRINSIC
low complexity region	1709	1728	N/A	INTRINSIC
low complexity region	1751	1760	N/A	INTRINSIC
low complexity region	1780	1798	N/A	INTRINSIC
low complexity region	1933	1949	N/A	INTRINSIC
coiled coil region	2023	2051	N/A	INTRINSIC
low complexity region	2056	2072	N/A	INTRINSIC
low complexity region	2166	2176	N/A	INTRINSIC
low complexity region	2207	2222	N/A	INTRINSIC
low complexity region	2230	2243	N/A	INTRINSIC
low complexity region	2290	2312	N/A	INTRINSIC
low complexity region	2342	2367	N/A	INTRINSIC
low complexity region	2390	2427	N/A	INTRINSIC
low complexity region	2451	2470	N/A	INTRINSIC
low complexity region	2476	2493	N/A	INTRINSIC
low complexity region	2505	2535	N/A	INTRINSIC
low complexity region	2545	2578	N/A	INTRINSIC
coiled coil region	2604	2642	N/A	INTRINSIC
coiled coil region	2691	2719	N/A	INTRINSIC
low complexity region	2778	2815	N/A	INTRINSIC
low complexity region	2828	2851	N/A	INTRINSIC
PHD	2859	2906	5.32e-9	SMART
BROMO	2915	3023	5.5e-37	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]

Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Asah1	C	T	8: 41,354,055	V111M	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Cyp7a1	A	G	4: 6,272,788	S142P	possibly damaging	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gtf2a1l	T	A	17: 88,694,658	V314E	probably null	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pik3cb	T	C	9: 99,064,099	D558G	possibly damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Bptf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00553:Bptf	APN	11	107055279	missense	possibly damaging	0.88
IGL00664:Bptf	APN	11	107077665	missense	possibly damaging	0.78
IGL00705:Bptf	APN	11	107095708	splice site	probably benign
IGL00796:Bptf	APN	11	107054550	missense	probably damaging	1.00
IGL00834:Bptf	APN	11	107073928	missense	possibly damaging	0.59
IGL01155:Bptf	APN	11	107080727	missense	probably damaging	1.00
IGL01314:Bptf	APN	11	107054853	missense	probably damaging	1.00
IGL01371:Bptf	APN	11	107055907	missense	probably benign	0.00
IGL01567:Bptf	APN	11	107058774	missense	probably damaging	1.00
IGL01794:Bptf	APN	11	107053221	critical splice donor site	probably null
IGL02108:Bptf	APN	11	107074988	missense	probably benign	0.45
IGL02367:Bptf	APN	11	107073352	missense	probably benign
IGL02437:Bptf	APN	11	107074695	missense	probably benign	0.00
IGL02589:Bptf	APN	11	107111531	missense	possibly damaging	0.92
IGL02897:Bptf	APN	11	107047121	missense	probably damaging	1.00
IGL02935:Bptf	APN	11	107080799	missense	probably damaging	1.00
IGL02954:Bptf	APN	11	107054749	missense	possibly damaging	0.89
IGL02982:Bptf	APN	11	107076674	missense	probably damaging	1.00
IGL03109:Bptf	APN	11	107061701	missense	possibly damaging	0.53
IGL03265:Bptf	APN	11	107054628	missense	probably benign	0.00
IGL03403:Bptf	APN	11	107099733	missense	possibly damaging	0.51
IGL03097:Bptf	UTSW	11	107077680	missense	probably damaging	1.00
PIT4486001:Bptf	UTSW	11	107054788	missense	probably damaging	0.98
R0066:Bptf	UTSW	11	107062136	missense	possibly damaging	0.90
R0157:Bptf	UTSW	11	107074658	missense	possibly damaging	0.89
R0320:Bptf	UTSW	11	107072819	missense	probably damaging	1.00
R0328:Bptf	UTSW	11	107047127	missense	probably damaging	1.00
R0402:Bptf	UTSW	11	107074114	missense	probably damaging	1.00
R0482:Bptf	UTSW	11	107081262	missense	probably benign	0.13
R0574:Bptf	UTSW	11	107076527	missense	probably damaging	1.00
R0598:Bptf	UTSW	11	107072965	missense	probably damaging	0.99
R0599:Bptf	UTSW	11	107068382	missense	probably damaging	1.00
R0601:Bptf	UTSW	11	107061692	missense	probably benign	0.04
R0744:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0836:Bptf	UTSW	11	107110812	critical splice donor site	probably null
R0885:Bptf	UTSW	11	107043791	missense	probably damaging	1.00
R1070:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1252:Bptf	UTSW	11	107073251	missense	probably benign	0.00
R1370:Bptf	UTSW	11	107047094	missense	probably damaging	0.99
R1428:Bptf	UTSW	11	107073047	missense	probably damaging	0.99
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1467:Bptf	UTSW	11	107055055	missense	possibly damaging	0.92
R1742:Bptf	UTSW	11	107110951	missense	probably damaging	1.00
R1816:Bptf	UTSW	11	107060579	missense	probably damaging	1.00
R1858:Bptf	UTSW	11	107073301	missense	probably benign	0.00
R1989:Bptf	UTSW	11	107074826	missense	probably damaging	1.00
R2253:Bptf	UTSW	11	107111322	missense	probably damaging	1.00
R2392:Bptf	UTSW	11	107072747	missense	probably damaging	1.00
R2431:Bptf	UTSW	11	107047240	missense	possibly damaging	0.48
R3022:Bptf	UTSW	11	107111637	critical splice acceptor site	probably null
R3161:Bptf	UTSW	11	107074476	missense	probably damaging	1.00
R3686:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3687:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3688:Bptf	UTSW	11	107074198	missense	probably benign	0.25
R3787:Bptf	UTSW	11	107073827	missense	probably damaging	1.00
R3834:Bptf	UTSW	11	107073857	missense	probably benign	0.05
R3885:Bptf	UTSW	11	107074513	missense	probably damaging	0.97
R4090:Bptf	UTSW	11	107081523	missense	probably damaging	0.99
R4398:Bptf	UTSW	11	107110844	missense	probably damaging	1.00
R4437:Bptf	UTSW	11	107074474	missense	possibly damaging	0.59
R4514:Bptf	UTSW	11	107077692	missense	probably damaging	1.00
R4565:Bptf	UTSW	11	107073010	missense	probably damaging	1.00
R4715:Bptf	UTSW	11	107047181	missense	probably damaging	1.00
R4748:Bptf	UTSW	11	107095880	missense	probably damaging	0.96
R4764:Bptf	UTSW	11	107043694	missense	probably damaging	1.00
R4885:Bptf	UTSW	11	107074648	missense	probably benign	0.39
R4901:Bptf	UTSW	11	107110860	nonsense	probably null
R4995:Bptf	UTSW	11	107054565	missense	probably damaging	0.98
R5057:Bptf	UTSW	11	107082528	missense	probably damaging	0.98
R5120:Bptf	UTSW	11	107073385	missense	probably damaging	0.99
R5320:Bptf	UTSW	11	107081367	nonsense	probably null
R5329:Bptf	UTSW	11	107073295	missense	probably benign	0.06
R5418:Bptf	UTSW	11	107111294	missense	probably damaging	1.00
R5461:Bptf	UTSW	11	107061764	missense	probably damaging	1.00
R5664:Bptf	UTSW	11	107073699	missense	probably benign	0.01
R5718:Bptf	UTSW	11	107111434	missense	probably damaging	1.00
R5774:Bptf	UTSW	11	107111137	missense	probably damaging	1.00
R5851:Bptf	UTSW	11	107110862	missense	probably damaging	1.00
R5930:Bptf	UTSW	11	107073196	missense	probably damaging	1.00
R5949:Bptf	UTSW	11	107111089	missense	probably damaging	0.99
R5975:Bptf	UTSW	11	107035864	utr 3 prime	probably benign
R6027:Bptf	UTSW	11	107074945	missense	probably damaging	1.00
R6337:Bptf	UTSW	11	107058779	missense	possibly damaging	0.89
R6407:Bptf	UTSW	11	107111126	missense	probably damaging	1.00
R6470:Bptf	UTSW	11	107072767	missense	probably damaging	1.00
R6487:Bptf	UTSW	11	107077726	missense	probably damaging	0.99
R6501:Bptf	UTSW	11	107077683	missense	probably null	1.00
R6755:Bptf	UTSW	11	107047256	missense	probably benign	0.27
R6861:Bptf	UTSW	11	107062565	missense	probably damaging	1.00
R6866:Bptf	UTSW	11	107073580	missense	probably damaging	1.00
R6879:Bptf	UTSW	11	107042690	missense	probably benign	0.32
R6927:Bptf	UTSW	11	107054595	missense	probably damaging	1.00
R6944:Bptf	UTSW	11	107080823	missense	probably damaging	1.00
R7082:Bptf	UTSW	11	107086747	missense	probably benign	0.00
R7136:Bptf	UTSW	11	107099715	missense	probably damaging	1.00
R7162:Bptf	UTSW	11	107043631	critical splice donor site	probably null
R7171:Bptf	UTSW	11	107131407	missense	unknown
R7193:Bptf	UTSW	11	107054809	nonsense	probably null
R7210:Bptf	UTSW	11	107054464	nonsense	probably null
R7221:Bptf	UTSW	11	107054832	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107073109	missense	probably damaging	1.00
R7316:Bptf	UTSW	11	107110914	nonsense	probably null
R7422:Bptf	UTSW	11	107060558	missense	probably damaging	1.00
R7454:Bptf	UTSW	11	107044640	missense	probably benign	0.03
R7657:Bptf	UTSW	11	107074729	missense	probably damaging	1.00
R7718:Bptf	UTSW	11	107081456	missense	possibly damaging	0.65
Z1088:Bptf	UTSW	11	107074582	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CGTGCTTAGACTAGGAGGACTG -3'
(R):5'- ACAGAGTCACACGTGAGCAG -3'

Sequencing Primer
(F):5'- CTTAGACTAGGAGGACTGATGCC -3'
(R):5'- AGTCACACGTGAGCAGTCTGG -3'

Posted On

2017-10-10