Incidental Mutation 'R6128:Bptf'
ID 487526
Institutional Source Beutler Lab
Gene Symbol Bptf
Ensembl Gene ENSMUSG00000040481
Gene Name bromodomain PHD finger transcription factor
Synonyms Falz, 9430093H17Rik
MMRRC Submission 044275-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6128 (G1)
Quality Score 225.009
Status Not validated
Chromosome 11
Chromosomal Location 106923907-107022953 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 106965516 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Aspartic acid at position 1163 (A1163D)
Ref Sequence ENSEMBL: ENSMUSP00000102373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057892] [ENSMUST00000106762] [ENSMUST00000106763]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000057892
AA Change: A1111D

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052303
Gene: ENSMUSG00000040481
AA Change: A1111D

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
coiled coil region 864 894 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 987 998 N/A INTRINSIC
low complexity region 1062 1072 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1225 1238 N/A INTRINSIC
low complexity region 1251 1265 N/A INTRINSIC
low complexity region 1491 1503 N/A INTRINSIC
low complexity region 1594 1613 N/A INTRINSIC
low complexity region 1636 1645 N/A INTRINSIC
low complexity region 1665 1683 N/A INTRINSIC
low complexity region 1818 1834 N/A INTRINSIC
coiled coil region 1908 1936 N/A INTRINSIC
low complexity region 1941 1957 N/A INTRINSIC
low complexity region 2051 2061 N/A INTRINSIC
low complexity region 2092 2107 N/A INTRINSIC
low complexity region 2115 2128 N/A INTRINSIC
low complexity region 2175 2197 N/A INTRINSIC
low complexity region 2227 2252 N/A INTRINSIC
low complexity region 2275 2312 N/A INTRINSIC
low complexity region 2336 2355 N/A INTRINSIC
low complexity region 2361 2378 N/A INTRINSIC
low complexity region 2390 2420 N/A INTRINSIC
low complexity region 2430 2463 N/A INTRINSIC
coiled coil region 2489 2527 N/A INTRINSIC
coiled coil region 2576 2604 N/A INTRINSIC
low complexity region 2663 2700 N/A INTRINSIC
low complexity region 2713 2736 N/A INTRINSIC
PHD 2744 2791 5.32e-9 SMART
BROMO 2800 2908 5.5e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000106762
AA Change: A1163D

PolyPhen 2 Score 0.873 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000102373
Gene: ENSMUSG00000040481
AA Change: A1163D

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.7e-8 PFAM
PHD 404 447 2.23e-11 SMART
internal_repeat_1 589 642 6.48e-5 PROSPERO
low complexity region 644 654 N/A INTRINSIC
low complexity region 662 679 N/A INTRINSIC
coiled coil region 926 956 N/A INTRINSIC
low complexity region 1013 1025 N/A INTRINSIC
low complexity region 1039 1050 N/A INTRINSIC
low complexity region 1114 1124 N/A INTRINSIC
low complexity region 1138 1150 N/A INTRINSIC
low complexity region 1277 1290 N/A INTRINSIC
low complexity region 1303 1317 N/A INTRINSIC
internal_repeat_1 1387 1440 6.48e-5 PROSPERO
low complexity region 1543 1555 N/A INTRINSIC
low complexity region 1646 1665 N/A INTRINSIC
low complexity region 1688 1697 N/A INTRINSIC
low complexity region 1717 1735 N/A INTRINSIC
low complexity region 1870 1886 N/A INTRINSIC
coiled coil region 1960 1988 N/A INTRINSIC
low complexity region 1993 2009 N/A INTRINSIC
low complexity region 2103 2113 N/A INTRINSIC
low complexity region 2144 2159 N/A INTRINSIC
low complexity region 2167 2180 N/A INTRINSIC
low complexity region 2227 2249 N/A INTRINSIC
low complexity region 2279 2304 N/A INTRINSIC
low complexity region 2327 2364 N/A INTRINSIC
low complexity region 2388 2407 N/A INTRINSIC
low complexity region 2413 2430 N/A INTRINSIC
low complexity region 2442 2472 N/A INTRINSIC
low complexity region 2482 2515 N/A INTRINSIC
coiled coil region 2541 2579 N/A INTRINSIC
coiled coil region 2628 2656 N/A INTRINSIC
low complexity region 2715 2752 N/A INTRINSIC
low complexity region 2765 2788 N/A INTRINSIC
PHD 2796 2843 5.32e-9 SMART
BROMO 2852 2960 5.5e-37 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000106763
AA Change: A1226D

PolyPhen 2 Score 0.415 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000102374
Gene: ENSMUSG00000040481
AA Change: A1226D

DomainStartEndE-ValueType
low complexity region 12 44 N/A INTRINSIC
low complexity region 49 62 N/A INTRINSIC
low complexity region 77 119 N/A INTRINSIC
low complexity region 137 197 N/A INTRINSIC
low complexity region 202 215 N/A INTRINSIC
DDT 252 312 2.02e-23 SMART
Pfam:WHIM1 351 400 4.9e-8 PFAM
PHD 404 447 2.23e-11 SMART
low complexity region 624 639 N/A INTRINSIC
low complexity region 707 717 N/A INTRINSIC
low complexity region 725 742 N/A INTRINSIC
coiled coil region 989 1019 N/A INTRINSIC
low complexity region 1076 1088 N/A INTRINSIC
low complexity region 1102 1113 N/A INTRINSIC
low complexity region 1177 1187 N/A INTRINSIC
low complexity region 1201 1213 N/A INTRINSIC
low complexity region 1340 1353 N/A INTRINSIC
low complexity region 1366 1380 N/A INTRINSIC
low complexity region 1606 1618 N/A INTRINSIC
low complexity region 1709 1728 N/A INTRINSIC
low complexity region 1751 1760 N/A INTRINSIC
low complexity region 1780 1798 N/A INTRINSIC
low complexity region 1933 1949 N/A INTRINSIC
coiled coil region 2023 2051 N/A INTRINSIC
low complexity region 2056 2072 N/A INTRINSIC
low complexity region 2166 2176 N/A INTRINSIC
low complexity region 2207 2222 N/A INTRINSIC
low complexity region 2230 2243 N/A INTRINSIC
low complexity region 2290 2312 N/A INTRINSIC
low complexity region 2342 2367 N/A INTRINSIC
low complexity region 2390 2427 N/A INTRINSIC
low complexity region 2451 2470 N/A INTRINSIC
low complexity region 2476 2493 N/A INTRINSIC
low complexity region 2505 2535 N/A INTRINSIC
low complexity region 2545 2578 N/A INTRINSIC
coiled coil region 2604 2642 N/A INTRINSIC
coiled coil region 2691 2719 N/A INTRINSIC
low complexity region 2778 2815 N/A INTRINSIC
low complexity region 2828 2851 N/A INTRINSIC
PHD 2859 2906 5.32e-9 SMART
BROMO 2915 3023 5.5e-37 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the reactivity of its encoded protein to a monoclonal antibody prepared against brain homogenates from patients with Alzheimer's disease. Analysis of the original protein (fetal Alz-50 reactive clone 1, or FAC1), identified as an 810 aa protein containing a DNA-binding domain and a zinc finger motif, suggested it might play a role in the regulation of transcription. High levels of FAC1 were detected in fetal brain and in patients with neurodegenerative diseases. The protein encoded by this gene is actually much larger than originally thought, and it also contains a C-terminal bromodomain characteristic of proteins that regulate transcription during proliferation. The encoded protein is highly similar to the largest subunit of the Drosophila NURF (nucleosome remodeling factor) complex. In Drosophila, the NURF complex, which catalyzes nucleosome sliding on DNA and interacts with sequence-specific transcription factors, is necessary for the chromatin remodeling required for transcription. Two alternative transcripts encoding different isoforms have been described completely. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis with embryonic growth arrest around early gastrulation and a greatly reduced ectoplacental cone. [provided by MGI curators]
Allele List at MGI

All alleles(58) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(56)

Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,786,596 (GRCm39) I7M unknown Het
A430033K04Rik A G 5: 138,646,038 (GRCm39) H641R probably damaging Het
Acyp2 C T 11: 30,456,354 (GRCm39) E98K possibly damaging Het
Asah1 C T 8: 41,807,092 (GRCm39) V111M probably damaging Het
Ascc3 T C 10: 50,526,734 (GRCm39) L611P probably damaging Het
Atl2 C A 17: 80,172,470 (GRCm39) probably null Het
Bhlhe22 A T 3: 18,109,987 (GRCm39) S346C probably damaging Het
Bicc1 T C 10: 70,776,313 (GRCm39) probably null Het
Bub1b T A 2: 118,448,293 (GRCm39) C382S probably benign Het
Carmil1 A T 13: 24,197,177 (GRCm39) Y158* probably null Het
Ccdc175 A T 12: 72,175,933 (GRCm39) I473K probably benign Het
Ccdc18 A G 5: 108,311,625 (GRCm39) I444V possibly damaging Het
Cep131 T A 11: 119,956,801 (GRCm39) I880F probably damaging Het
Ces2e T A 8: 105,655,428 (GRCm39) I117N probably benign Het
Clk2 C T 3: 89,081,531 (GRCm39) T289M probably damaging Het
Crocc2 A T 1: 93,122,123 (GRCm39) D672V probably benign Het
Cul7 T A 17: 46,962,588 (GRCm39) I73N probably damaging Het
Cyp2d12 C A 15: 82,443,166 (GRCm39) D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 (GRCm39) S142P possibly damaging Het
Daw1 T A 1: 83,183,647 (GRCm39) C232* probably null Het
Dhx9 T C 1: 153,353,835 (GRCm39) K195R probably damaging Het
Dnase1l1 C T X: 73,320,644 (GRCm39) probably null Het
Dpp3 A G 19: 4,972,420 (GRCm39) V168A probably benign Het
Eml2 G A 7: 18,935,088 (GRCm39) V432I probably damaging Het
Ercc6l2 T C 13: 64,001,563 (GRCm39) V459A probably damaging Het
Erp44 A T 4: 48,243,493 (GRCm39) N38K probably damaging Het
Fam135a A G 1: 24,069,821 (GRCm39) probably null Het
Fblim1 G A 4: 141,312,033 (GRCm39) R231C probably damaging Het
Fdps T C 3: 89,006,740 (GRCm39) E117G possibly damaging Het
Gbp4 A C 5: 105,283,030 (GRCm39) V80G possibly damaging Het
Glt1d1 A T 5: 127,754,335 (GRCm39) D179V probably damaging Het
Gtf2a1l T A 17: 89,002,086 (GRCm39) V314E probably null Het
Gzmf G T 14: 56,443,443 (GRCm39) Y178* probably null Het
Hira C T 16: 18,751,727 (GRCm39) P509S probably benign Het
Ifi44 T C 3: 151,454,823 (GRCm39) N134S probably benign Het
Igfbp2 T A 1: 72,863,958 (GRCm39) C74S probably damaging Het
Il24 A G 1: 130,813,435 (GRCm39) L54P probably damaging Het
Ints10 T C 8: 69,274,904 (GRCm39) probably null Het
Ipo9 A G 1: 135,318,311 (GRCm39) C700R possibly damaging Het
Kalrn T A 16: 34,033,255 (GRCm39) Q469L probably damaging Het
Lrp1b T G 2: 40,750,667 (GRCm39) I2966L probably benign Het
Lta C A 17: 35,422,817 (GRCm39) V169L possibly damaging Het
Lyst T C 13: 13,933,964 (GRCm39) V3554A possibly damaging Het
Mobp A G 9: 119,997,392 (GRCm39) probably benign Het
Myorg T A 4: 41,498,445 (GRCm39) N395I probably damaging Het
Or10d1 C G 9: 39,484,549 (GRCm39) R2T probably benign Het
Or4b1d A T 2: 89,968,954 (GRCm39) C176* probably null Het
Or8c14-ps1 T C 9: 38,101,299 (GRCm39) S93P probably benign Het
Pacs1 A T 19: 5,202,400 (GRCm39) probably null Het
Phf21a G T 2: 92,181,953 (GRCm39) probably null Het
Pick1 T A 15: 79,123,896 (GRCm39) M89K probably damaging Het
Pik3cb T C 9: 98,946,152 (GRCm39) D558G possibly damaging Het
Pnma8a A G 7: 16,694,661 (GRCm39) D172G probably benign Het
Polr2a A C 11: 69,627,803 (GRCm39) V1368G probably damaging Het
Pomt2 A G 12: 87,158,109 (GRCm39) probably null Het
Pou2f1 T C 1: 165,703,056 (GRCm39) probably benign Het
Rnf145 T C 11: 44,446,018 (GRCm39) V284A probably damaging Het
Robo1 A T 16: 72,809,956 (GRCm39) M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,229,111 (GRCm39) probably benign Het
Ryr3 C T 2: 112,784,639 (GRCm39) probably null Het
Scamp1 A C 13: 94,344,735 (GRCm39) L202R possibly damaging Het
Snx25 C T 8: 46,558,240 (GRCm39) V110I probably benign Het
Spata31e2 G A 1: 26,724,506 (GRCm39) P225S probably benign Het
Susd6 T A 12: 80,915,388 (GRCm39) H124Q possibly damaging Het
Tarm1 T C 7: 3,537,720 (GRCm39) T248A probably benign Het
Tc2n A G 12: 101,675,748 (GRCm39) M1T probably null Het
Tcerg1 C A 18: 42,644,563 (GRCm39) probably null Het
Ticrr C A 7: 79,343,716 (GRCm39) P1194T probably damaging Het
Trim31 T G 17: 37,220,491 (GRCm39) V469G probably benign Het
Vcp T C 4: 42,980,941 (GRCm39) E723G probably benign Het
Vmn1r177 C A 7: 23,565,267 (GRCm39) S203I probably damaging Het
Vmn1r177 T A 7: 23,565,268 (GRCm39) S203C probably damaging Het
Vmn1r210 A T 13: 23,012,277 (GRCm39) L3* probably null Het
Wdr27 T A 17: 15,152,796 (GRCm39) R104* probably null Het
Wnk1 A C 6: 119,940,747 (GRCm39) probably null Het
Zfp157 A G 5: 138,453,281 (GRCm39) E88G possibly damaging Het
Zfp708 A T 13: 67,222,965 (GRCm39) L22Q probably damaging Het
Zfp788 T C 7: 41,299,785 (GRCm39) F787S probably damaging Het
Other mutations in Bptf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bptf APN 11 106,946,105 (GRCm39) missense possibly damaging 0.88
IGL00664:Bptf APN 11 106,968,491 (GRCm39) missense possibly damaging 0.78
IGL00705:Bptf APN 11 106,986,534 (GRCm39) splice site probably benign
IGL00796:Bptf APN 11 106,945,376 (GRCm39) missense probably damaging 1.00
IGL00834:Bptf APN 11 106,964,754 (GRCm39) missense possibly damaging 0.59
IGL01155:Bptf APN 11 106,971,553 (GRCm39) missense probably damaging 1.00
IGL01314:Bptf APN 11 106,945,679 (GRCm39) missense probably damaging 1.00
IGL01371:Bptf APN 11 106,946,733 (GRCm39) missense probably benign 0.00
IGL01567:Bptf APN 11 106,949,600 (GRCm39) missense probably damaging 1.00
IGL01794:Bptf APN 11 106,944,047 (GRCm39) critical splice donor site probably null
IGL02108:Bptf APN 11 106,965,814 (GRCm39) missense probably benign 0.45
IGL02367:Bptf APN 11 106,964,178 (GRCm39) missense probably benign
IGL02437:Bptf APN 11 106,965,521 (GRCm39) missense probably benign 0.00
IGL02589:Bptf APN 11 107,002,357 (GRCm39) missense possibly damaging 0.92
IGL02897:Bptf APN 11 106,937,947 (GRCm39) missense probably damaging 1.00
IGL02935:Bptf APN 11 106,971,625 (GRCm39) missense probably damaging 1.00
IGL02954:Bptf APN 11 106,945,575 (GRCm39) missense possibly damaging 0.89
IGL02982:Bptf APN 11 106,967,500 (GRCm39) missense probably damaging 1.00
IGL03109:Bptf APN 11 106,952,527 (GRCm39) missense possibly damaging 0.53
IGL03265:Bptf APN 11 106,945,454 (GRCm39) missense probably benign 0.00
IGL03403:Bptf APN 11 106,990,559 (GRCm39) missense possibly damaging 0.51
Anodyne UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
Arroyo UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
mojado UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
IGL03097:Bptf UTSW 11 106,968,506 (GRCm39) missense probably damaging 1.00
PIT4486001:Bptf UTSW 11 106,945,614 (GRCm39) missense probably damaging 0.98
R0066:Bptf UTSW 11 106,952,962 (GRCm39) missense possibly damaging 0.90
R0157:Bptf UTSW 11 106,965,484 (GRCm39) missense possibly damaging 0.89
R0320:Bptf UTSW 11 106,963,645 (GRCm39) missense probably damaging 1.00
R0328:Bptf UTSW 11 106,937,953 (GRCm39) missense probably damaging 1.00
R0402:Bptf UTSW 11 106,964,940 (GRCm39) missense probably damaging 1.00
R0482:Bptf UTSW 11 106,972,088 (GRCm39) missense probably benign 0.13
R0574:Bptf UTSW 11 106,967,353 (GRCm39) missense probably damaging 1.00
R0598:Bptf UTSW 11 106,963,791 (GRCm39) missense probably damaging 0.99
R0599:Bptf UTSW 11 106,959,208 (GRCm39) missense probably damaging 1.00
R0601:Bptf UTSW 11 106,952,518 (GRCm39) missense probably benign 0.04
R0744:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0836:Bptf UTSW 11 107,001,638 (GRCm39) critical splice donor site probably null
R0885:Bptf UTSW 11 106,934,617 (GRCm39) missense probably damaging 1.00
R1070:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1252:Bptf UTSW 11 106,964,077 (GRCm39) missense probably benign 0.00
R1370:Bptf UTSW 11 106,937,920 (GRCm39) missense probably damaging 0.99
R1428:Bptf UTSW 11 106,963,873 (GRCm39) missense probably damaging 0.99
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1467:Bptf UTSW 11 106,945,881 (GRCm39) missense possibly damaging 0.92
R1742:Bptf UTSW 11 107,001,777 (GRCm39) missense probably damaging 1.00
R1816:Bptf UTSW 11 106,951,405 (GRCm39) missense probably damaging 1.00
R1858:Bptf UTSW 11 106,964,127 (GRCm39) missense probably benign 0.00
R1989:Bptf UTSW 11 106,965,652 (GRCm39) missense probably damaging 1.00
R2253:Bptf UTSW 11 107,002,148 (GRCm39) missense probably damaging 1.00
R2392:Bptf UTSW 11 106,963,573 (GRCm39) missense probably damaging 1.00
R2431:Bptf UTSW 11 106,938,066 (GRCm39) missense possibly damaging 0.48
R3022:Bptf UTSW 11 107,002,463 (GRCm39) critical splice acceptor site probably null
R3161:Bptf UTSW 11 106,965,302 (GRCm39) missense probably damaging 1.00
R3686:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3687:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3688:Bptf UTSW 11 106,965,024 (GRCm39) missense probably benign 0.25
R3787:Bptf UTSW 11 106,964,653 (GRCm39) missense probably damaging 1.00
R3834:Bptf UTSW 11 106,964,683 (GRCm39) missense probably benign 0.05
R3885:Bptf UTSW 11 106,965,339 (GRCm39) missense probably damaging 0.97
R4090:Bptf UTSW 11 106,972,349 (GRCm39) missense probably damaging 0.99
R4398:Bptf UTSW 11 107,001,670 (GRCm39) missense probably damaging 1.00
R4437:Bptf UTSW 11 106,965,300 (GRCm39) missense possibly damaging 0.59
R4514:Bptf UTSW 11 106,968,518 (GRCm39) missense probably damaging 1.00
R4565:Bptf UTSW 11 106,963,836 (GRCm39) missense probably damaging 1.00
R4715:Bptf UTSW 11 106,938,007 (GRCm39) missense probably damaging 1.00
R4748:Bptf UTSW 11 106,986,706 (GRCm39) missense probably damaging 0.96
R4764:Bptf UTSW 11 106,934,520 (GRCm39) missense probably damaging 1.00
R4885:Bptf UTSW 11 106,965,474 (GRCm39) missense probably benign 0.39
R4901:Bptf UTSW 11 107,001,686 (GRCm39) nonsense probably null
R4995:Bptf UTSW 11 106,945,391 (GRCm39) missense probably damaging 0.98
R5057:Bptf UTSW 11 106,973,354 (GRCm39) missense probably damaging 0.98
R5120:Bptf UTSW 11 106,964,211 (GRCm39) missense probably damaging 0.99
R5320:Bptf UTSW 11 106,972,193 (GRCm39) nonsense probably null
R5329:Bptf UTSW 11 106,964,121 (GRCm39) missense probably benign 0.06
R5418:Bptf UTSW 11 107,002,120 (GRCm39) missense probably damaging 1.00
R5461:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R5664:Bptf UTSW 11 106,964,525 (GRCm39) missense probably benign 0.01
R5718:Bptf UTSW 11 107,002,260 (GRCm39) missense probably damaging 1.00
R5774:Bptf UTSW 11 107,001,963 (GRCm39) missense probably damaging 1.00
R5851:Bptf UTSW 11 107,001,688 (GRCm39) missense probably damaging 1.00
R5930:Bptf UTSW 11 106,964,022 (GRCm39) missense probably damaging 1.00
R5949:Bptf UTSW 11 107,001,915 (GRCm39) missense probably damaging 0.99
R5975:Bptf UTSW 11 106,926,690 (GRCm39) utr 3 prime probably benign
R6027:Bptf UTSW 11 106,965,771 (GRCm39) missense probably damaging 1.00
R6337:Bptf UTSW 11 106,949,605 (GRCm39) missense possibly damaging 0.89
R6407:Bptf UTSW 11 107,001,952 (GRCm39) missense probably damaging 1.00
R6470:Bptf UTSW 11 106,963,593 (GRCm39) missense probably damaging 1.00
R6487:Bptf UTSW 11 106,968,552 (GRCm39) missense probably damaging 0.99
R6501:Bptf UTSW 11 106,968,509 (GRCm39) missense probably null 1.00
R6755:Bptf UTSW 11 106,938,082 (GRCm39) missense probably benign 0.27
R6861:Bptf UTSW 11 106,953,391 (GRCm39) missense probably damaging 1.00
R6866:Bptf UTSW 11 106,964,406 (GRCm39) missense probably damaging 1.00
R6879:Bptf UTSW 11 106,933,516 (GRCm39) missense probably benign 0.32
R6927:Bptf UTSW 11 106,945,421 (GRCm39) missense probably damaging 1.00
R6944:Bptf UTSW 11 106,971,649 (GRCm39) missense probably damaging 1.00
R7082:Bptf UTSW 11 106,977,573 (GRCm39) missense probably benign 0.00
R7136:Bptf UTSW 11 106,990,541 (GRCm39) missense probably damaging 1.00
R7162:Bptf UTSW 11 106,934,457 (GRCm39) critical splice donor site probably null
R7171:Bptf UTSW 11 107,022,233 (GRCm39) missense unknown
R7193:Bptf UTSW 11 106,945,635 (GRCm39) nonsense probably null
R7210:Bptf UTSW 11 106,945,290 (GRCm39) nonsense probably null
R7221:Bptf UTSW 11 106,945,658 (GRCm39) missense probably damaging 1.00
R7316:Bptf UTSW 11 107,001,740 (GRCm39) nonsense probably null
R7316:Bptf UTSW 11 106,963,935 (GRCm39) missense probably damaging 1.00
R7422:Bptf UTSW 11 106,951,384 (GRCm39) missense probably damaging 1.00
R7454:Bptf UTSW 11 106,935,466 (GRCm39) missense probably benign 0.03
R7657:Bptf UTSW 11 106,965,555 (GRCm39) missense probably damaging 1.00
R7718:Bptf UTSW 11 106,972,282 (GRCm39) missense possibly damaging 0.65
R7827:Bptf UTSW 11 106,938,013 (GRCm39) missense probably benign 0.01
R7844:Bptf UTSW 11 106,964,887 (GRCm39) missense probably damaging 0.97
R7992:Bptf UTSW 11 107,001,709 (GRCm39) missense probably benign 0.00
R8001:Bptf UTSW 11 106,938,166 (GRCm39) nonsense probably null
R8037:Bptf UTSW 11 106,946,776 (GRCm39) missense probably damaging 1.00
R8122:Bptf UTSW 11 106,927,417 (GRCm39) critical splice acceptor site probably null
R8235:Bptf UTSW 11 106,967,458 (GRCm39) missense probably benign 0.04
R8308:Bptf UTSW 11 106,943,815 (GRCm39) missense probably damaging 0.99
R8409:Bptf UTSW 11 106,953,495 (GRCm39) missense probably damaging 1.00
R8464:Bptf UTSW 11 107,022,168 (GRCm39) missense probably benign 0.01
R8477:Bptf UTSW 11 106,943,679 (GRCm39) missense probably damaging 0.98
R8482:Bptf UTSW 11 106,934,524 (GRCm39) missense probably benign 0.19
R8515:Bptf UTSW 11 106,946,064 (GRCm39) missense possibly damaging 0.85
R8519:Bptf UTSW 11 106,952,590 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,140 (GRCm39) missense probably damaging 1.00
R8708:Bptf UTSW 11 106,964,139 (GRCm39) missense probably damaging 0.99
R8722:Bptf UTSW 11 107,022,295 (GRCm39) missense unknown
R8732:Bptf UTSW 11 106,931,206 (GRCm39) missense probably damaging 1.00
R8783:Bptf UTSW 11 107,022,357 (GRCm39) missense unknown
R8828:Bptf UTSW 11 106,945,836 (GRCm39) missense probably damaging 0.98
R9004:Bptf UTSW 11 106,945,713 (GRCm39) missense probably damaging 1.00
R9010:Bptf UTSW 11 106,964,576 (GRCm39) missense probably damaging 1.00
R9035:Bptf UTSW 11 106,963,842 (GRCm39) missense probably damaging 1.00
R9083:Bptf UTSW 11 106,959,176 (GRCm39) missense probably damaging 1.00
R9211:Bptf UTSW 11 106,946,124 (GRCm39) missense probably damaging 1.00
R9345:Bptf UTSW 11 106,971,588 (GRCm39) missense possibly damaging 0.77
R9393:Bptf UTSW 11 106,965,134 (GRCm39) missense probably benign 0.00
R9451:Bptf UTSW 11 106,935,411 (GRCm39) missense probably damaging 1.00
R9561:Bptf UTSW 11 106,964,954 (GRCm39) nonsense probably null
R9632:Bptf UTSW 11 106,952,545 (GRCm39) missense probably damaging 1.00
R9648:Bptf UTSW 11 106,943,720 (GRCm39) missense probably damaging 0.99
R9650:Bptf UTSW 11 106,935,412 (GRCm39) missense probably benign 0.15
R9658:Bptf UTSW 11 107,002,170 (GRCm39) missense probably damaging 1.00
R9775:Bptf UTSW 11 106,934,502 (GRCm39) missense probably benign 0.04
R9776:Bptf UTSW 11 106,969,396 (GRCm39) missense probably damaging 1.00
Z1088:Bptf UTSW 11 106,965,408 (GRCm39) missense probably benign 0.00
Z1176:Bptf UTSW 11 106,949,510 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTGCTTAGACTAGGAGGACTG -3'
(R):5'- ACAGAGTCACACGTGAGCAG -3'

Sequencing Primer
(F):5'- CTTAGACTAGGAGGACTGATGCC -3'
(R):5'- AGTCACACGTGAGCAGTCTGG -3'
Posted On 2017-10-10