Mutagenetix > Incidental Mutations

Incidental Mutation 'R0523:Tnfrsf21'

48753

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf21

Ensembl Gene

ENSMUSG00000023915

Gene Name

tumor necrosis factor receptor superfamily, member 21

Synonyms

DR6, TR7, Death receptor 6

MMRRC Submission

038716-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R0523 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

43016555-43089188 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 43038213 bp

Zygosity

Heterozygous

Amino Acid Change

Histidine to Tyrosine at position 239 (H239Y)

Ref Sequence

ENSEMBL: ENSMUSP00000024708 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024708]

Predicted Effect

probably benign
Transcript: ENSMUST00000024708
AA Change: H239Y

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000024708
Gene: ENSMUSG00000023915
AA Change: H239Y

Domain	Start	End	E-Value	Type
TNFR	50	88	1.58e1	SMART
TNFR	91	131	3.42e-3	SMART
TNFR	133	168	9.31e-5	SMART
TNFR	171	211	1.1e-1	SMART
transmembrane domain	351	370	N/A	INTRINSIC
DEATH	393	498	1.41e-22	SMART
low complexity region	511	526	N/A	INTRINSIC
low complexity region	562	575	N/A	INTRINSIC
PDB:2DBH\|A	576	655	5e-48	PDB

Meta Mutation Damage Score

0.0680

Coding Region Coverage

1x: 99.2%
3x: 98.4%
10x: 96.5%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tumor necrosis factor receptor superfamily. The encoded protein activates nuclear factor kappa-B and mitogen-activated protein kinase 8 (also called c-Jun N-terminal kinase 1), and induces cell apoptosis. Through its death domain, the encoded receptor interacts with tumor necrosis factor receptor type 1-associated death domain (TRADD) protein, which is known to mediate signal transduction of tumor necrosis factor receptors. Knockout studies in mice suggest that this gene plays a role in T-helper cell activation, and may be involved in inflammation and immune regulation. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired T cell differentiation and an enhanced Th2 response. Mice homozygous for a different knock-out allele show increased CD4+ T cell proliferation and Th2 cytokine production, and enhanced B cell proliferation, survival, and humoral responses. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 85 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,644,629	M1K	probably null	Het
2410089E03Rik	T	A	15: 8,194,386	Y878N	probably damaging	Het
A2ml1	T	C	6: 128,558,326	D807G	possibly damaging	Het
Actl9	T	A	17: 33,433,349	W128R	probably damaging	Het
Aggf1	T	C	13: 95,356,416	I562V	probably damaging	Het
Ano3	T	A	2: 110,884,855	E79D	probably benign	Het
Apobec1	T	A	6: 122,581,545	I84F	probably damaging	Het
Atp6v1b2	T	C	8: 69,109,985	F458L	possibly damaging	Het
BC051142	G	T	17: 34,445,499		probably null	Het
Bco2	A	T	9: 50,534,626	V490E	probably damaging	Het
Catsperg1	G	A	7: 29,185,190		probably benign	Het
Cdc37	T	C	9: 21,142,996	K111R	probably damaging	Het
Cfap54	T	C	10: 92,908,883		probably benign	Het
Cpox	T	A	16: 58,675,245	C308*	probably null	Het
Ctnna3	T	G	10: 64,675,909	M626R	probably damaging	Het
Cyp2c68	T	C	19: 39,739,429	E93G	probably benign	Het
Cyp2s1	G	A	7: 25,806,050	R330W	probably damaging	Het
Diaph1	C	T	18: 37,856,500	V860I	possibly damaging	Het
Dicer1	A	G	12: 104,702,491	S1311P	probably damaging	Het
Dpyd	G	A	3: 118,899,203	R332K	probably benign	Het
E130308A19Rik	G	A	4: 59,719,716	R416H	probably damaging	Het
Eef1d	T	C	15: 75,903,156	D218G	probably benign	Het
Eif2ak1	T	C	5: 143,882,166	V215A	probably damaging	Het
Eif2ak4	T	C	2: 118,442,096		probably null	Het
Fam71e2	A	G	7: 4,759,393	S246P	possibly damaging	Het
Fcrl5	T	C	3: 87,457,792	S583P	possibly damaging	Het
Grid2ip	C	A	5: 143,373,043	Q29K	possibly damaging	Het
Htr1f	A	T	16: 64,925,899	N343K	probably damaging	Het
Hvcn1	T	C	5: 122,216,365		probably null	Het
Igf2r	T	C	17: 12,692,064	I1956V	probably benign	Het
Impdh2	A	T	9: 108,561,819		probably null	Het
Impdh2	C	T	9: 108,561,820	T96I	possibly damaging	Het
Lactb	C	G	9: 66,970,692	G285A	probably benign	Het
Lrrc43	T	C	5: 123,501,242	S445P	probably damaging	Het
Maats1	G	A	16: 38,328,374	P231S	probably damaging	Het
Mapk12	T	G	15: 89,135,645	M120L	probably benign	Het
Mroh8	C	G	2: 157,224,036	A669P	probably damaging	Het
Mrpl38	A	C	11: 116,132,018	H373Q	probably benign	Het
Myocd	A	G	11: 65,180,902	V740A	probably damaging	Het
Naprt	A	G	15: 75,892,465	F300S	probably damaging	Het
Ncam2	T	C	16: 81,461,643	I271T	probably damaging	Het
Nek4	A	G	14: 30,980,038	T582A	probably benign	Het
Notch2	C	T	3: 98,070,970	T89I	probably benign	Het
Notch2	G	A	3: 98,111,598	R692H	probably benign	Het
Nt5c3	A	T	6: 56,883,681	N296K	probably damaging	Het
Nt5c3b	T	A	11: 100,436,210	I87F	probably damaging	Het
Oas3	T	C	5: 120,766,144	Q555R	unknown	Het
Olfr1013	T	A	2: 85,769,929	S43T	probably benign	Het
Olfr494	A	T	7: 108,368,231	H247L	probably damaging	Het
Olfr699	A	G	7: 106,790,326	V225A	probably damaging	Het
P3h1	C	A	4: 119,241,530	Q410K	probably benign	Het
Pax3	A	G	1: 78,195,441	V44A	possibly damaging	Het
Pde1c	T	A	6: 56,174,941	L252F	probably damaging	Het
Pdzd7	T	A	19: 45,036,090	T497S	probably benign	Het
Piezo2	T	C	18: 63,022,481	T253A	probably damaging	Het
Pipox	T	C	11: 77,892,139	E79G	probably damaging	Het
Pole	G	T	5: 110,303,593	M829I	probably damaging	Het
Ppp1r12c	A	T	7: 4,489,772	L156Q	probably damaging	Het
Psme2b	T	G	11: 48,945,782	T113P	probably damaging	Het
Ptprq	A	G	10: 107,580,220	I1739T	possibly damaging	Het
Qser1	T	C	2: 104,789,676	T174A	probably damaging	Het
Rcor3	T	G	1: 192,130,436	D81A	probably damaging	Het
Rev3l	T	C	10: 39,848,049	V785A	probably benign	Het
Rnf11	T	C	4: 109,456,922	D90G	probably benign	Het
Sh3tc1	GCCTCCTCCTCCTCCTCC	GCCTCCTCCTCCTCC	5: 35,724,066		probably benign	Het
Smad2	T	A	18: 76,262,552	S21T	probably benign	Het
Smc4	A	G	3: 69,025,888	D639G	probably damaging	Het
Smtn	A	T	11: 3,524,664	S716T	possibly damaging	Het
Smug1	G	T	15: 103,155,709	Q262K	probably benign	Het
Sspo	G	T	6: 48,451,860	G403V	probably benign	Het
Tas2r131	A	G	6: 132,957,451	F132L	possibly damaging	Het
Tgm3	T	C	2: 130,044,662		probably null	Het
Tigd2	C	T	6: 59,210,373	T75M	probably benign	Het
Tnfrsf13b	T	C	11: 61,147,587	V232A	probably benign	Het
Trim47	A	G	11: 116,107,890	L301S	probably damaging	Het
Trim75	G	A	8: 64,983,790	H3Y	probably benign	Het
Trp53bp1	C	A	2: 121,251,868	A317S	probably null	Het
Ttc29	G	C	8: 78,276,837	L227F	probably benign	Het
Ttc39d	G	A	17: 80,216,457	D182N	possibly damaging	Het
Ttll10	T	A	4: 156,045,361	R164*	probably null	Het
Ufsp2	T	A	8: 45,996,743	D447E	probably benign	Het
Ugt2b37	T	A	5: 87,251,832	L272F	possibly damaging	Het
Vps13b	T	C	15: 35,472,050	V833A	probably benign	Het
Zbbx	T	C	3: 75,081,858	T308A	probably benign	Het
Zfp933	G	A	4: 147,826,462	Q226*	probably null	Het

Other mutations in Tnfrsf21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01406:Tnfrsf21	APN	17	43037946	missense	probably damaging	1.00
IGL01663:Tnfrsf21	APN	17	43087811	missense	probably benign	0.13
IGL01811:Tnfrsf21	APN	17	43037613	missense	probably benign
IGL01916:Tnfrsf21	APN	17	43039803	missense	probably benign	0.00
IGL01934:Tnfrsf21	APN	17	43065187	missense	probably benign	0.15
IGL02184:Tnfrsf21	APN	17	43085463	missense	probably benign	0.37
IGL02292:Tnfrsf21	APN	17	43039911	missense	probably benign
IGL02385:Tnfrsf21	APN	17	43040051	missense	probably damaging	1.00
IGL02710:Tnfrsf21	APN	17	43087929	missense	probably damaging	0.97
IGL03001:Tnfrsf21	APN	17	43087895	missense	probably damaging	0.99
IGL03003:Tnfrsf21	APN	17	43039943	missense	probably damaging	1.00
PIT4480001:Tnfrsf21	UTSW	17	43037911	missense	probably benign	0.00
R0007:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0046:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0088:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0091:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0102:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0103:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0105:Tnfrsf21	UTSW	17	43040191	critical splice donor site	probably null
R0206:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0211:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0240:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0243:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0308:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0363:Tnfrsf21	UTSW	17	43037877	missense	probably benign	0.01
R0456:Tnfrsf21	UTSW	17	43038091	missense	probably benign	0.01
R0522:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0525:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0528:Tnfrsf21	UTSW	17	43037614	missense	probably benign
R0543:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0549:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0550:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0699:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0724:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0734:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0847:Tnfrsf21	UTSW	17	43038213	missense	probably benign
R0880:Tnfrsf21	UTSW	17	43037842	nonsense	probably null
R1591:Tnfrsf21	UTSW	17	43085374	missense	probably benign	0.01
R2069:Tnfrsf21	UTSW	17	43037938	missense	possibly damaging	0.67
R2153:Tnfrsf21	UTSW	17	43087872	missense	probably damaging	1.00
R2323:Tnfrsf21	UTSW	17	43085529	nonsense	probably null
R3941:Tnfrsf21	UTSW	17	43038010	missense	probably damaging	1.00
R4438:Tnfrsf21	UTSW	17	43087842	missense	possibly damaging	0.49
R4509:Tnfrsf21	UTSW	17	43085388	missense	probably benign	0.00
R4510:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4511:Tnfrsf21	UTSW	17	43065019	missense	probably damaging	0.98
R4708:Tnfrsf21	UTSW	17	43038232	missense	possibly damaging	0.66
R4721:Tnfrsf21	UTSW	17	43085504	missense	probably damaging	1.00
R4811:Tnfrsf21	UTSW	17	43037730	missense	probably benign	0.00
R5437:Tnfrsf21	UTSW	17	43037862	missense	possibly damaging	0.55
R5767:Tnfrsf21	UTSW	17	43037659	missense	probably damaging	0.98
R6057:Tnfrsf21	UTSW	17	43039715	missense	possibly damaging	0.86
R6392:Tnfrsf21	UTSW	17	43017088	missense	probably benign	0.00
R6860:Tnfrsf21	UTSW	17	43017066	missense	probably benign
R7253:Tnfrsf21	UTSW	17	43037667	missense	probably benign	0.00
R7288:Tnfrsf21	UTSW	17	43037818	missense	possibly damaging	0.86
R7643:Tnfrsf21	UTSW	17	43037916	missense	probably benign	0.00
R7937:Tnfrsf21	UTSW	17	43037925	missense	probably benign	0.01
R8098:Tnfrsf21	UTSW	17	43039899	missense	probably benign
R8495:Tnfrsf21	UTSW	17	43038237	missense	probably benign
V3553:Tnfrsf21	UTSW	17	43037931	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGAAGTGTAAAGCTCACACGGACTG -3'
(R):5'- GCTCCATCTACACACGATTAGCTCC -3'

Sequencing Primer
(F):5'- GGACTGTCTGGGTCAGAAC -3'
(R):5'- acaactaaaatcactcaactcactc -3'

Posted On

2013-06-12