Incidental Mutation 'R6128:Scamp1'
ID487537
Institutional Source Beutler Lab
Gene Symbol Scamp1
Ensembl Gene ENSMUSG00000021687
Gene Namesecretory carrier membrane protein 1
Synonyms
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome13
Chromosomal Location94201310-94285857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 94208227 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 202 (L202R)
Ref Sequence ENSEMBL: ENSMUSP00000123135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022197] [ENSMUST00000152555] [ENSMUST00000153558]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022197
AA Change: L254R

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000022197
Gene: ENSMUSG00000021687
AA Change: L254R

DomainStartEndE-ValueType
coiled coil region 75 114 N/A INTRINSIC
Pfam:SCAMP 117 292 7.4e-74 PFAM
low complexity region 314 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152555
AA Change: L202R

PolyPhen 2 Score 0.796 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000123135
Gene: ENSMUSG00000021687
AA Change: L202R

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000153558
AA Change: L202R

PolyPhen 2 Score 0.490 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000120053
Gene: ENSMUSG00000021687
AA Change: L202R

DomainStartEndE-ValueType
coiled coil region 23 62 N/A INTRINSIC
Pfam:SCAMP 64 241 2.3e-78 PFAM
low complexity region 262 280 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to the SCAMP family of proteins, which are secretory carrier membrane proteins. They function as carriers to the cell surface in post-golgi recycling pathways. Different family members are highly related products of distinct genes, and are usually expressed together. These findings suggest that these protein family members may function at the same site during vesicular transport rather than in separate pathways. A pseudogene of this gene has been defined on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any overt abnormalities, but final cell capacitance of mast cells completing exocytosis was smaller than controls and an increased proportion of reversible fusion events was noted. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Scamp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Scamp1 APN 13 94204022 missense probably damaging 1.00
IGL02269:Scamp1 APN 13 94232186 splice site probably benign
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0067:Scamp1 UTSW 13 94204150 missense probably damaging 1.00
R0254:Scamp1 UTSW 13 94210580 missense probably benign 0.00
R0367:Scamp1 UTSW 13 94210580 missense probably benign 0.01
R0559:Scamp1 UTSW 13 94208182 missense possibly damaging 0.79
R1147:Scamp1 UTSW 13 94224886 unclassified probably null
R1400:Scamp1 UTSW 13 94224947 missense possibly damaging 0.53
R1499:Scamp1 UTSW 13 94224929 missense probably benign 0.03
R5206:Scamp1 UTSW 13 94232107 missense probably damaging 1.00
R5259:Scamp1 UTSW 13 94232086 missense probably benign
R5300:Scamp1 UTSW 13 94204162 missense probably damaging 0.99
R7017:Scamp1 UTSW 13 94224915 missense probably damaging 0.98
R7219:Scamp1 UTSW 13 94224907 missense probably damaging 1.00
R7242:Scamp1 UTSW 13 94233140 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAATGAGCCAGAGTCCCACG -3'
(R):5'- CAGACACAGACTGGTGCTTCTTAG -3'

Sequencing Primer
(F):5'- GAGTCCCACGGTCTAACAGCAG -3'
(R):5'- CTTCTTAGCTGTGGGACCCG -3'
Posted On2017-10-10