Incidental Mutation 'R6128:Pick1'
ID487539
Institutional Source Beutler Lab
Gene Symbol Pick1
Ensembl Gene ENSMUSG00000116121
Gene Name
SynonymsPrkcabp
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome15
Chromosomal Location79229391-79256674 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79239696 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 89 (M89K)
Ref Sequence ENSEMBL: ENSMUSP00000061125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018295] [ENSMUST00000053926] [ENSMUST00000163571] [ENSMUST00000166155]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018295
AA Change: M89K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018295
Gene: ENSMUSG00000068206
AA Change: M89K

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000053926
AA Change: M89K

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000061125
Gene: ENSMUSG00000116121
AA Change: M89K

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 363 1.18e-103 SMART
GLECT 393 530 7.99e-3 SMART
Gal-bind_lectin 399 530 4.49e-22 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000163571
AA Change: M89K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128126
Gene: ENSMUSG00000068206
AA Change: M89K

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000165609
Predicted Effect possibly damaging
Transcript: ENSMUST00000166155
AA Change: M89K

PolyPhen 2 Score 0.564 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000129468
Gene: ENSMUSG00000068206
AA Change: M89K

DomainStartEndE-ValueType
PDZ 31 105 2.12e-13 SMART
Arfaptin 117 352 1.69e-122 SMART
low complexity region 380 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168513
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169548
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171365
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a PDZ domain, through which it interacts with protein kinase C, alpha (PRKCA). This protein may function as an adaptor that binds to and organizes the subcellular localization of a variety of membrane proteins. It has been shown to interact with multiple glutamate receptor subtypes, monoamine plasma membrane transporters, as well as non-voltage gated sodium channels, and may target PRKCA to these membrane proteins and thus regulate their distribution and function. This protein has also been found to act as an anchoring protein that specifically targets PRKCA to mitochondria in a ligand-specific manner. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele show impaired synaptic plasticity and lack of long-term depression; males are infertile due to reduced sperm count and impaired sperm motility, and display small testes and seminiferous tubules, malformed acrosomes, globozoospermia, and male germ cell apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Pick1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Pick1 APN 15 79247257 splice site probably benign
IGL03137:Pick1 APN 15 79245301 missense possibly damaging 0.61
IGL03366:Pick1 APN 15 79241281 missense probably damaging 0.97
FR4976:Pick1 UTSW 15 79255946 frame shift probably null
R1590:Pick1 UTSW 15 79245301 missense probably benign 0.40
R2114:Pick1 UTSW 15 79255581 unclassified probably benign
R2115:Pick1 UTSW 15 79255581 unclassified probably benign
R2219:Pick1 UTSW 15 79239699 missense probably damaging 1.00
R4624:Pick1 UTSW 15 79246466 missense probably damaging 1.00
R4646:Pick1 UTSW 15 79248937 missense probably benign 0.26
R4796:Pick1 UTSW 15 79255610 unclassified probably benign
R5420:Pick1 UTSW 15 79248840 missense probably benign 0.01
R5869:Pick1 UTSW 15 79248895 missense probably benign 0.02
R6047:Pick1 UTSW 15 79255695 unclassified probably benign
R6291:Pick1 UTSW 15 79251728 intron probably null
R7042:Pick1 UTSW 15 79248765 missense probably damaging 0.98
R7564:Pick1 UTSW 15 79255581 missense unknown
Predicted Primers PCR Primer
(F):5'- CCTTTGTTGGCACTACCTGAGG -3'
(R):5'- GAGTGTTCAGCATCTCTGGG -3'

Sequencing Primer
(F):5'- TTGGCACTACCTGAGGTGGAAG -3'
(R):5'- AGTGTTCAGCATCTCTGGGAACTC -3'
Posted On2017-10-10