Incidental Mutation 'R6128:Kalrn'
ID487542
Institutional Source Beutler Lab
Gene Symbol Kalrn
Ensembl Gene ENSMUSG00000061751
Gene Namekalirin, RhoGEF kinase
Synonyms2210407G14Rik, Hapip, E530005C20Rik, LOC224126
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.923) question?
Stock #R6128 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location33969073-34573532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34212885 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 469 (Q469L)
Ref Sequence ENSEMBL: ENSMUSP00000110604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076810] [ENSMUST00000089655] [ENSMUST00000114947] [ENSMUST00000114949] [ENSMUST00000114953] [ENSMUST00000114954] [ENSMUST00000114960] [ENSMUST00000114961] [ENSMUST00000151491]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076810
AA Change: Q1083L

PolyPhen 2 Score 0.712 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000076088
Gene: ENSMUSG00000061751
AA Change: Q1083L

DomainStartEndE-ValueType
SEC14 20 159 2.22e-30 SMART
SPEC 173 289 5.32e-9 SMART
SPEC 295 397 1.19e-11 SMART
SPEC 400 515 1.83e0 SMART
SPEC 521 623 9.84e-13 SMART
SPEC 626 748 2.74e-2 SMART
SPEC 875 976 8.11e-14 SMART
SPEC 1106 1208 4.7e-10 SMART
RhoGEF 1258 1428 3.6e-56 SMART
PH 1442 1555 5.24e-8 SMART
SH3 1622 1683 1.23e-7 SMART
RhoGEF 1904 2074 1.47e-52 SMART
PH 2094 2199 9.87e-4 SMART
SH3 2295 2356 2.78e-2 SMART
IGc2 2455 2527 4.28e-12 SMART
FN3 2541 2623 3.07e-11 SMART
S_TKc 2656 2910 1.28e-71 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000089655
AA Change: Q1110L

PolyPhen 2 Score 0.875 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000087084
Gene: ENSMUSG00000061751
AA Change: Q1110L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 1003 1.85e-8 SMART
SPEC 1133 1235 4.7e-10 SMART
RhoGEF 1285 1455 3.6e-56 SMART
PH 1469 1582 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114947
AA Change: Q456L

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110597
Gene: ENSMUSG00000061751
AA Change: Q456L

DomainStartEndE-ValueType
SPEC 3 112 4.22e-3 SMART
internal_repeat_1 128 187 9.63e-6 PROSPERO
SPEC 239 349 1.85e-8 SMART
SPEC 479 581 4.7e-10 SMART
RhoGEF 631 801 3.6e-56 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114949
AA Change: Q460L

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110599
Gene: ENSMUSG00000061751
AA Change: Q460L

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 2.9e-5 PROSPERO
SPEC 252 353 8.11e-14 SMART
SPEC 483 585 4.7e-10 SMART
RhoGEF 635 805 3.6e-56 SMART
PH 819 932 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114953
AA Change: Q469L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110603
Gene: ENSMUSG00000061751
AA Change: Q469L

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114954
AA Change: Q469L

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000110604
Gene: ENSMUSG00000061751
AA Change: Q469L

DomainStartEndE-ValueType
SPEC 3 125 2.74e-2 SMART
internal_repeat_1 141 204 4.18e-5 PROSPERO
coiled coil region 217 248 N/A INTRINSIC
SPEC 252 362 1.85e-8 SMART
SPEC 492 594 4.7e-10 SMART
RhoGEF 644 814 3.6e-56 SMART
PH 828 941 5.24e-8 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000114960
AA Change: Q1101L

PolyPhen 2 Score 0.553 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000110611
Gene: ENSMUSG00000061751
AA Change: Q1101L

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
SEC14 38 177 2.22e-30 SMART
SPEC 191 307 5.32e-9 SMART
SPEC 313 415 1.19e-11 SMART
SPEC 418 533 1.83e0 SMART
SPEC 539 641 9.84e-13 SMART
SPEC 644 766 2.74e-2 SMART
SPEC 893 994 8.11e-14 SMART
SPEC 1124 1226 4.7e-10 SMART
RhoGEF 1276 1446 3.6e-56 SMART
PH 1460 1573 5.24e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114961
SMART Domains Protein: ENSMUSP00000110612
Gene: ENSMUSG00000061751

DomainStartEndE-ValueType
SEC14 40 179 2.22e-30 SMART
SPEC 193 309 5.32e-9 SMART
SPEC 315 417 1.19e-11 SMART
SPEC 420 535 1.83e0 SMART
SPEC 541 643 9.84e-13 SMART
SPEC 646 768 2.74e-2 SMART
SPEC 895 996 8.11e-14 SMART
SPEC 1126 1228 4.7e-10 SMART
RhoGEF 1278 1448 3.6e-56 SMART
PH 1462 1575 5.24e-8 SMART
SH3 1642 1703 1.23e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142817
AA Change: Q1078L

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116188
Gene: ENSMUSG00000061751
AA Change: Q1078L

DomainStartEndE-ValueType
SEC14 16 155 2.22e-30 SMART
SPEC 169 285 5.32e-9 SMART
SPEC 291 393 1.19e-11 SMART
SPEC 396 511 1.83e0 SMART
SPEC 517 619 9.84e-13 SMART
SPEC 622 744 2.74e-2 SMART
SPEC 871 972 8.11e-14 SMART
SPEC 1102 1204 4.7e-10 SMART
RhoGEF 1254 1424 3.6e-56 SMART
PH 1438 1551 5.24e-8 SMART
SH3 1618 1679 1.23e-7 SMART
RhoGEF 1900 2070 1.47e-52 SMART
PH 2090 2195 9.87e-4 SMART
SH3 2291 2352 2.78e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000151491
AA Change: Q857L

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123416
Gene: ENSMUSG00000061751
AA Change: Q857L

DomainStartEndE-ValueType
SEC14 26 165 2.22e-30 SMART
SPEC 179 295 5.32e-9 SMART
SPEC 301 403 1.19e-11 SMART
SPEC 640 750 1.85e-8 SMART
SPEC 880 982 4.7e-10 SMART
RhoGEF 1032 1202 3.6e-56 SMART
PH 1216 1329 5.24e-8 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Huntington's disease (HD), a neurodegenerative disorder characterized by loss of striatal neurons, is caused by an expansion of a polyglutamine tract in the HD protein huntingtin. This gene encodes a protein that interacts with the huntingtin-associated protein 1, which is a huntingtin binding protein that may function in vesicle trafficking. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele specific for isoform 7 exhibit decreased anxiety-related behavior, contextual conditioning, and synapse formation. Mice homozygous for another knock-out allele exhibit impaired AMPA-mediated synaptic currents and abnormal behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Kalrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01361:Kalrn APN 16 34175722 splice site probably benign
IGL01364:Kalrn APN 16 34262629 missense probably damaging 1.00
IGL01510:Kalrn APN 16 34235330 missense possibly damaging 0.52
IGL01664:Kalrn APN 16 34294161 missense probably damaging 1.00
IGL01934:Kalrn APN 16 34198512 splice site probably null
IGL02059:Kalrn APN 16 34252341 missense possibly damaging 0.95
IGL02102:Kalrn APN 16 34220222 missense probably damaging 1.00
IGL02306:Kalrn APN 16 34310527 missense probably damaging 0.97
IGL02328:Kalrn APN 16 34332224 missense probably damaging 0.98
IGL02532:Kalrn APN 16 34360846 missense probably damaging 1.00
IGL02685:Kalrn APN 16 34513959 nonsense probably null
IGL02696:Kalrn APN 16 34220114 missense probably damaging 1.00
IGL02708:Kalrn APN 16 34392050 missense probably damaging 1.00
IGL02937:Kalrn APN 16 34220130 nonsense probably null
IGL03188:Kalrn APN 16 34314192 missense probably benign 0.01
IGL03289:Kalrn APN 16 34385297 missense possibly damaging 0.90
IGL03408:Kalrn APN 16 34314176 missense probably damaging 0.99
Hidden UTSW 16 34027976 missense probably damaging 1.00
PIT4498001:Kalrn UTSW 16 34031582 missense possibly damaging 0.81
R0019:Kalrn UTSW 16 34198514 splice site probably benign
R0043:Kalrn UTSW 16 34054906 missense probably damaging 1.00
R0052:Kalrn UTSW 16 34357171 missense probably damaging 1.00
R0066:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0098:Kalrn UTSW 16 33975619 missense possibly damaging 0.89
R0111:Kalrn UTSW 16 34031590 missense probably damaging 1.00
R0113:Kalrn UTSW 16 34049936 intron probably benign
R0183:Kalrn UTSW 16 34171379 splice site probably null
R0422:Kalrn UTSW 16 34314273 missense probably damaging 0.99
R0498:Kalrn UTSW 16 34054891 missense possibly damaging 0.61
R0614:Kalrn UTSW 16 33993670 splice site probably benign
R0656:Kalrn UTSW 16 34032467 missense probably damaging 1.00
R0671:Kalrn UTSW 16 34116408 missense probably benign 0.04
R0707:Kalrn UTSW 16 34010581 missense possibly damaging 0.88
R0709:Kalrn UTSW 16 34035554 missense probably damaging 1.00
R0834:Kalrn UTSW 16 34049919 missense possibly damaging 0.94
R0976:Kalrn UTSW 16 34385390 missense probably damaging 1.00
R1297:Kalrn UTSW 16 34016498 missense probably damaging 0.99
R1355:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1370:Kalrn UTSW 16 33975584 missense possibly damaging 0.74
R1389:Kalrn UTSW 16 33988803 missense probably benign 0.01
R1398:Kalrn UTSW 16 34212820 missense probably damaging 1.00
R1427:Kalrn UTSW 16 33975754 missense probably damaging 1.00
R1458:Kalrn UTSW 16 34174487 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1470:Kalrn UTSW 16 34187471 missense probably damaging 1.00
R1557:Kalrn UTSW 16 34314278 missense possibly damaging 0.92
R1559:Kalrn UTSW 16 34010548 missense possibly damaging 0.92
R1654:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1703:Kalrn UTSW 16 34205326 missense probably damaging 1.00
R1759:Kalrn UTSW 16 34360950 missense probably damaging 0.97
R1764:Kalrn UTSW 16 34212873 missense probably damaging 1.00
R1824:Kalrn UTSW 16 34294215 missense probably damaging 1.00
R1845:Kalrn UTSW 16 34356961 missense probably damaging 0.99
R1850:Kalrn UTSW 16 33975923 missense probably damaging 0.98
R1921:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1922:Kalrn UTSW 16 34392093 missense probably benign 0.02
R1970:Kalrn UTSW 16 33977524 critical splice donor site probably null
R1991:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R1992:Kalrn UTSW 16 33975738 missense probably damaging 1.00
R2001:Kalrn UTSW 16 34028045 missense probably damaging 1.00
R2025:Kalrn UTSW 16 34189736 missense probably damaging 0.96
R2048:Kalrn UTSW 16 34252310 missense probably benign 0.18
R2076:Kalrn UTSW 16 34332143 missense probably benign 0.15
R2118:Kalrn UTSW 16 34332230 missense possibly damaging 0.84
R2136:Kalrn UTSW 16 34307724 missense possibly damaging 0.82
R2145:Kalrn UTSW 16 34009262 unclassified probably benign
R2193:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2195:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2234:Kalrn UTSW 16 34176262 splice site probably null
R2404:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2405:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2408:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2411:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2570:Kalrn UTSW 16 34310495 missense probably damaging 1.00
R2903:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2904:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R2924:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R3411:Kalrn UTSW 16 34212272 missense probably benign 0.07
R3693:Kalrn UTSW 16 34357315 missense probably damaging 1.00
R3709:Kalrn UTSW 16 34392030 splice site probably null
R3788:Kalrn UTSW 16 34220240 missense probably damaging 1.00
R3833:Kalrn UTSW 16 34039889 nonsense probably null
R3871:Kalrn UTSW 16 34203856 splice site probably null
R3934:Kalrn UTSW 16 34310531 missense probably benign 0.34
R4033:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4056:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4057:Kalrn UTSW 16 34314209 missense probably damaging 0.99
R4303:Kalrn UTSW 16 34235391 missense probably damaging 1.00
R4402:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4444:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4482:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4487:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4558:Kalrn UTSW 16 33987208 missense possibly damaging 0.46
R4572:Kalrn UTSW 16 34392042 missense probably damaging 0.98
R4583:Kalrn UTSW 16 34235267 missense probably damaging 1.00
R4604:Kalrn UTSW 16 34513926 missense possibly damaging 0.46
R4620:Kalrn UTSW 16 34028705 missense probably damaging 0.99
R4651:Kalrn UTSW 16 34176391 missense probably damaging 1.00
R4703:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4704:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4705:Kalrn UTSW 16 34203957 missense probably damaging 1.00
R4760:Kalrn UTSW 16 34198487 missense probably damaging 1.00
R4793:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4794:Kalrn UTSW 16 33989810 missense possibly damaging 0.72
R4811:Kalrn UTSW 16 34356969 missense probably damaging 1.00
R4816:Kalrn UTSW 16 34514019 unclassified probably benign
R4888:Kalrn UTSW 16 34171330 missense probably damaging 1.00
R4952:Kalrn UTSW 16 34357415 intron probably null
R5030:Kalrn UTSW 16 33975742 missense probably benign 0.00
R5045:Kalrn UTSW 16 34314352 nonsense probably null
R5117:Kalrn UTSW 16 34033601 critical splice acceptor site probably null
R5289:Kalrn UTSW 16 34252341 missense possibly damaging 0.95
R5426:Kalrn UTSW 16 34262653 missense probably damaging 1.00
R5432:Kalrn UTSW 16 34053622 missense probably damaging 1.00
R5611:Kalrn UTSW 16 34175780 missense probably damaging 1.00
R5629:Kalrn UTSW 16 34039934 missense possibly damaging 0.77
R5635:Kalrn UTSW 16 34014084 missense probably damaging 1.00
R5713:Kalrn UTSW 16 34016579 missense probably benign
R5716:Kalrn UTSW 16 33987176 missense probably benign 0.01
R5772:Kalrn UTSW 16 33975820 missense probably damaging 1.00
R5797:Kalrn UTSW 16 34212249 missense probably damaging 0.98
R5835:Kalrn UTSW 16 33987091 missense probably benign 0.28
R5895:Kalrn UTSW 16 33975435 utr 3 prime probably benign
R5924:Kalrn UTSW 16 34243833 missense probably damaging 1.00
R5999:Kalrn UTSW 16 34357343 missense probably damaging 1.00
R6010:Kalrn UTSW 16 34010580 missense probably benign 0.06
R6052:Kalrn UTSW 16 34360885 missense probably damaging 1.00
R6122:Kalrn UTSW 16 33985191 missense possibly damaging 0.82
R6136:Kalrn UTSW 16 34357111 missense probably damaging 1.00
R6178:Kalrn UTSW 16 34053639 missense possibly damaging 0.88
R6229:Kalrn UTSW 16 34055071 missense probably damaging 1.00
R6376:Kalrn UTSW 16 33975991 missense probably benign
R6397:Kalrn UTSW 16 33992985 missense probably damaging 1.00
R6429:Kalrn UTSW 16 34332164 missense possibly damaging 0.85
R6473:Kalrn UTSW 16 34205302 missense probably damaging 1.00
R6481:Kalrn UTSW 16 34360984 missense probably damaging 1.00
R6597:Kalrn UTSW 16 34182747 missense probably damaging 1.00
R6736:Kalrn UTSW 16 34217923 missense probably damaging 1.00
R6808:Kalrn UTSW 16 34027976 missense probably damaging 1.00
R6897:Kalrn UTSW 16 33975703 missense probably damaging 0.99
R6955:Kalrn UTSW 16 34220136 missense probably damaging 1.00
R7060:Kalrn UTSW 16 34357048 missense probably damaging 0.99
R7064:Kalrn UTSW 16 34217891 missense probably damaging 1.00
R7132:Kalrn UTSW 16 34256227 missense unknown
R7154:Kalrn UTSW 16 34212157 critical splice donor site probably null
R7181:Kalrn UTSW 16 34163077 missense probably benign 0.00
R7234:Kalrn UTSW 16 34176422 missense possibly damaging 0.63
R7235:Kalrn UTSW 16 34175761 missense probably benign 0.18
R7504:Kalrn UTSW 16 34256233 missense unknown
R7563:Kalrn UTSW 16 34392094 missense probably damaging 0.97
R7612:Kalrn UTSW 16 34314212 missense possibly damaging 0.68
Predicted Primers PCR Primer
(F):5'- GGAAACCTGTTGTCCCTTATCC -3'
(R):5'- GGTTGTTACCAAGCATTCCCC -3'

Sequencing Primer
(F):5'- ATCCTGCCACTTCCAGCC -3'
(R):5'- AAGCATTCCCCGCTCCTGG -3'
Posted On2017-10-10