Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Gtf2a1l'

487549

Institutional Source

Beutler Lab

Gene Symbol

Gtf2a1l

Ensembl Gene

ENSMUSG00000024154

Gene Name

general transcription factor IIA, 1-like

Synonyms

Gtf2a1lf, 1700011N16Rik, Alf

MMRRC Submission

044275-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.533) question?

Stock #

R6128 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

88668660-88715152 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 88694658 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Glutamic Acid at position 314 (V314E)

Ref Sequence

ENSEMBL: ENSMUSP00000024970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000024970] [ENSMUST00000161481]

Predicted Effect

probably null
Transcript: ENSMUST00000024970
AA Change: V314E

PolyPhen 2 Score 0.940 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000024970
Gene: ENSMUSG00000024154
AA Change: V314E

Domain	Start	End	E-Value	Type
TFIIA	9	468	6.87e-202	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000161481

SMART Domains

Protein: ENSMUSP00000124286
Gene: ENSMUSG00000024154

Domain	Start	End	E-Value	Type
Pfam:TFIIA	9	76	3.2e-29	PFAM
Pfam:TFIIA	70	243	3e-13	PFAM

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The assembly and stability of the RNA polymerase II transcription pre-initiation complex on a eukaryotic core promoter involve the effects of transcription factor IIA (TFIIA) on the interaction between TATA-binding protein (TBP) and DNA. This gene encodes a germ cell-specific counterpart of the large (alpha/beta) subunit of general transcription factor TFIIA that is able to stabilize the binding of TBP to DNA and may be uniquely important to testis biology. Alternative splicing for this locus has been observed and two variants, encoding distinct isoforms, have been identified. Co-transcription of this gene and the neighboring upstream gene generates a rare transcript (SALF), which encodes a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Mar 2014]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Asah1	C	T	8: 41,354,055	V111M	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bptf	G	T	11: 107,074,690	A1163D	possibly damaging	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Cyp7a1	A	G	4: 6,272,788	S142P	possibly damaging	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pik3cb	T	C	9: 99,064,099	D558G	possibly damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Gtf2a1l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00565:Gtf2a1l	APN	17	88694295	missense	probably damaging	1.00
IGL00928:Gtf2a1l	APN	17	88694462	missense	probably benign	0.09
IGL00974:Gtf2a1l	APN	17	88714949	missense	probably damaging	1.00
IGL01024:Gtf2a1l	APN	17	88671291	missense	probably damaging	1.00
IGL02429:Gtf2a1l	APN	17	88668713	start codon destroyed	probably null	0.61
IGL02658:Gtf2a1l	APN	17	88668718	missense	probably benign	0.01
IGL03377:Gtf2a1l	APN	17	88711593	missense	probably benign	0.03
R0848:Gtf2a1l	UTSW	17	88694229	missense	probably damaging	0.99
R0899:Gtf2a1l	UTSW	17	88668724	missense	possibly damaging	0.56
R1435:Gtf2a1l	UTSW	17	88694315	missense	probably damaging	1.00
R1716:Gtf2a1l	UTSW	17	88694580	missense	probably benign	0.06
R1861:Gtf2a1l	UTSW	17	88714954	missense	probably damaging	1.00
R2301:Gtf2a1l	UTSW	17	88711472	missense	probably benign
R2906:Gtf2a1l	UTSW	17	88694655	missense	possibly damaging	0.92
R4281:Gtf2a1l	UTSW	17	88711637	missense	possibly damaging	0.95
R4289:Gtf2a1l	UTSW	17	88694456	missense	probably damaging	0.98
R4771:Gtf2a1l	UTSW	17	88690020	missense	probably benign	0.23
R4904:Gtf2a1l	UTSW	17	88690043	critical splice donor site	probably null
R4941:Gtf2a1l	UTSW	17	88714922	missense	probably damaging	1.00
R5106:Gtf2a1l	UTSW	17	88694645	missense	possibly damaging	0.95
R6003:Gtf2a1l	UTSW	17	88694103	missense	probably damaging	1.00
R6035:Gtf2a1l	UTSW	17	88711534	missense	probably benign	0.00
R6035:Gtf2a1l	UTSW	17	88711534	missense	probably benign	0.00
R6246:Gtf2a1l	UTSW	17	88671547	missense	probably benign	0.09
R6481:Gtf2a1l	UTSW	17	88711625	missense	probably benign	0.09
R7344:Gtf2a1l	UTSW	17	88694103	missense	probably damaging	1.00
R7462:Gtf2a1l	UTSW	17	88694138	missense	possibly damaging	0.77

Predicted Primers

PCR Primer
(F):5'- GCAGGAAAGCTCTCCATACC -3'
(R):5'- GCCCTAACTCAAACTGACATTTG -3'

Sequencing Primer
(F):5'- TCTGACAGAGTCTAGCCTGGAG -3'
(R):5'- GACATTTGCAACTAGCCGTG -3'

Posted On

2017-10-10