Mutagenetix > Incidental Mutations

Incidental Mutation 'R6128:Dnase1l1'

487551

Institutional Source

Beutler Lab

Gene Symbol

Dnase1l1

Ensembl Gene

ENSMUSG00000019088

Gene Name

deoxyribonuclease 1-like 1

Synonyms

Dnase1ll, G4.8, Dnl1ll, 2310005K03Rik

MMRRC Submission

044275-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.069) question?

Stock #

R6128 (G1)

Quality Score

221.999

Status

Not validated

Chromosome

Chromosomal Location

74273217-74282337 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (1 bp from exon)

DNA Base Change (assembly)

C to T at 74277038 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000113515 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000151702] [ENSMUST00000135690]

Predicted Effect

probably benign
Transcript: ENSMUST00000008826

SMART Domains

Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.1e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000019232

SMART Domains

Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
DNaseIc	21	289	3.93e-149	SMART
low complexity region	301	313	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000074085

SMART Domains

Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.1e-34	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000075821

SMART Domains

Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
DNaseIc	21	289	3.93e-149	SMART
low complexity region	301	313	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000083047

Predicted Effect

probably null
Transcript: ENSMUST00000114189

SMART Domains

Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
Blast:DNaseIc	21	70	5e-22	BLAST
SCOP:d2dnja_	39	79	2e-4	SMART
low complexity region	91	103	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119361

SMART Domains

Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

Domain	Start	End	E-Value	Type
Blast:DNaseIc	21	64	2e-22	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000121868

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125775

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128763

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134330

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000144434

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148882

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149171

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146584

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000146260

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138954

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135012

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142142

Predicted Effect

probably benign
Transcript: ENSMUST00000151702

SMART Domains

Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	167	1.5e-34	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000135690

SMART Domains

Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_L16	5	150	1.2e-20	PFAM

Meta Mutation Damage Score

0.9711

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 78 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930553M12Rik	T	C	4: 88,868,359	I7M	unknown	Het
4931408C20Rik	G	A	1: 26,685,425	P225S	probably benign	Het
A430033K04Rik	A	G	5: 138,647,776	H641R	probably damaging	Het
Acyp2	C	T	11: 30,506,354	E98K	possibly damaging	Het
AI464131	T	A	4: 41,498,445	N395I	probably damaging	Het
Asah1	C	T	8: 41,354,055	V111M	probably damaging	Het
Ascc3	T	C	10: 50,650,638	L611P	probably damaging	Het
Atl2	C	A	17: 79,865,041		probably null	Het
Bhlhe22	A	T	3: 18,055,823	S346C	probably damaging	Het
Bicc1	T	C	10: 70,940,483		probably null	Het
Bptf	G	T	11: 107,074,690	A1163D	possibly damaging	Het
Bub1b	T	A	2: 118,617,812	C382S	probably benign	Het
Carmil1	A	T	13: 24,013,194	Y158*	probably null	Het
Ccdc175	A	T	12: 72,129,159	I473K	probably benign	Het
Ccdc18	A	G	5: 108,163,759	I444V	possibly damaging	Het
Cep131	T	A	11: 120,065,975	I880F	probably damaging	Het
Ces2e	T	A	8: 104,928,796	I117N	probably benign	Het
Clk2	C	T	3: 89,174,224	T289M	probably damaging	Het
Crocc2	A	T	1: 93,194,401	D672V	probably benign	Het
Cul7	T	A	17: 46,651,662	I73N	probably damaging	Het
Cyp2d12	C	A	15: 82,558,965	D358E	probably benign	Het
Cyp7a1	A	G	4: 6,272,788	S142P	possibly damaging	Het
Daw1	T	A	1: 83,205,926	C232*	probably null	Het
Dhx9	T	C	1: 153,478,089	K195R	probably damaging	Het
Dpp3	A	G	19: 4,922,392	V168A	probably benign	Het
Eml2	G	A	7: 19,201,163	V432I	probably damaging	Het
Ercc6l2	T	C	13: 63,853,749	V459A	probably damaging	Het
Erp44	A	T	4: 48,243,493	N38K	probably damaging	Het
Fam135a	A	G	1: 24,030,740		probably null	Het
Fblim1	G	A	4: 141,584,722	R231C	probably damaging	Het
Fdps	T	C	3: 89,099,433	E117G	possibly damaging	Het
Gbp4	A	C	5: 105,135,164	V80G	possibly damaging	Het
Glt1d1	A	T	5: 127,677,271	D179V	probably damaging	Het
Gtf2a1l	T	A	17: 88,694,658	V314E	probably null	Het
Gzmf	G	T	14: 56,205,986	Y178*	probably null	Het
Hira	C	T	16: 18,932,977	P509S	probably benign	Het
Ifi44	T	C	3: 151,749,186	N134S	probably benign	Het
Igfbp2	T	A	1: 72,824,799	C74S	probably damaging	Het
Il24	A	G	1: 130,885,698	L54P	probably damaging	Het
Ints10	T	C	8: 68,822,252		probably null	Het
Ipo9	A	G	1: 135,390,573	C700R	possibly damaging	Het
Kalrn	T	A	16: 34,212,885	Q469L	probably damaging	Het
Lrp1b	T	G	2: 40,860,655	I2966L	probably benign	Het
Lta	C	A	17: 35,203,841	V169L	possibly damaging	Het
Lyst	T	C	13: 13,759,379	V3554A	possibly damaging	Het
Mobp	A	G	9: 120,168,326		probably benign	Het
Olfr32	A	T	2: 90,138,610	C176*	probably null	Het
Olfr892-ps1	T	C	9: 38,190,003	S93P	probably benign	Het
Olfr959	C	G	9: 39,573,253	R2T	probably benign	Het
Pacs1	A	T	19: 5,152,372		probably null	Het
Phf21a	G	T	2: 92,351,608		probably null	Het
Pick1	T	A	15: 79,239,696	M89K	probably damaging	Het
Pik3cb	T	C	9: 99,064,099	D558G	possibly damaging	Het
Pnmal1	A	G	7: 16,960,736	D172G	probably benign	Het
Polr2a	A	C	11: 69,736,977	V1368G	probably damaging	Het
Pomt2	A	G	12: 87,111,335		probably null	Het
Pou2f1	T	C	1: 165,875,487		probably benign	Het
Rnf145	T	C	11: 44,555,191	V284A	probably damaging	Het
Robo1	A	T	16: 73,013,068	M1235L	probably benign	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Ryr3	C	T	2: 112,954,294		probably null	Het
Scamp1	A	C	13: 94,208,227	L202R	possibly damaging	Het
Snx25	C	T	8: 46,105,203	V110I	probably benign	Het
Susd6	T	A	12: 80,868,614	H124Q	possibly damaging	Het
Tarm1	T	C	7: 3,489,204	T248A	probably benign	Het
Tc2n	A	G	12: 101,709,489	M1T	probably null	Het
Tcerg1	C	A	18: 42,511,498		probably null	Het
Ticrr	C	A	7: 79,693,968	P1194T	probably damaging	Het
Trim31	T	G	17: 36,909,599	V469G	probably benign	Het
Vcp	T	C	4: 42,980,941	E723G	probably benign	Het
Vmn1r177	C	A	7: 23,865,842	S203I	probably damaging	Het
Vmn1r177	T	A	7: 23,865,843	S203C	probably damaging	Het
Vmn1r210	A	T	13: 22,828,107	L3*	probably null	Het
Wdr27	T	A	17: 14,932,534	R104*	probably null	Het
Wnk1	A	C	6: 119,963,786		probably null	Het
Zfp157	A	G	5: 138,455,019	E88G	possibly damaging	Het
Zfp708	A	T	13: 67,074,901	L22Q	probably damaging	Het
Zfp788	T	C	7: 41,650,361	F787S	probably damaging	Het

Other mutations in Dnase1l1

Allele	Source	Chr	Coord	Type	Predicted Effect
R4691:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4752:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4753:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4814:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4815:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4846:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4861:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4862:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4872:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4873:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4875:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4978:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4979:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4980:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4981:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4982:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R4983:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5039:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5084:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5085:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5086:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5087:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5106:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5107:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5108:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5109:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5137:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5171:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5266:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5296:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5330:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5417:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5418:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5419:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5448:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5450:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5466:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R5467:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6126:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6129:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6130:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6232:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6233:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6234:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6242:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6305:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6306:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6329:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6343:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6344:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6396:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6397:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6449:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6450:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6585:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6586:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6646:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6679:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6681:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6845:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R6847:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null
R8526:Dnase1l1	UTSW	X	74277038	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- TGTAAAGATTGGTACCAGAGTGGC -3'
(R):5'- TTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'

Posted On

2017-10-10