Incidental Mutation 'R6128:Dnase1l1'
ID487551
Institutional Source Beutler Lab
Gene Symbol Dnase1l1
Ensembl Gene ENSMUSG00000019088
Gene Namedeoxyribonuclease 1-like 1
SynonymsDnase1ll, G4.8, Dnl1ll, 2310005K03Rik
MMRRC Submission 044275-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.079) question?
Stock #R6128 (G1)
Quality Score221.999
Status Not validated
ChromosomeX
Chromosomal Location74273217-74282337 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 74277038 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008826] [ENSMUST00000019232] [ENSMUST00000074085] [ENSMUST00000075821] [ENSMUST00000114189] [ENSMUST00000119361] [ENSMUST00000135690] [ENSMUST00000151702]
Predicted Effect probably benign
Transcript: ENSMUST00000008826
SMART Domains Protein: ENSMUSP00000008826
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000019232
SMART Domains Protein: ENSMUSP00000019232
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074085
SMART Domains Protein: ENSMUSP00000082055
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.1e-34 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000075821
SMART Domains Protein: ENSMUSP00000075218
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
DNaseIc 21 289 3.93e-149 SMART
low complexity region 301 313 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083047
Predicted Effect probably null
Transcript: ENSMUST00000114189
SMART Domains Protein: ENSMUSP00000109827
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 70 5e-22 BLAST
SCOP:d2dnja_ 39 79 2e-4 SMART
low complexity region 91 103 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000119361
SMART Domains Protein: ENSMUSP00000113515
Gene: ENSMUSG00000019088

DomainStartEndE-ValueType
Blast:DNaseIc 21 64 2e-22 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125775
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128763
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134330
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135012
Predicted Effect probably benign
Transcript: ENSMUST00000135690
SMART Domains Protein: ENSMUSP00000119500
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 150 1.2e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142142
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146584
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148882
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149171
Predicted Effect probably benign
Transcript: ENSMUST00000151702
SMART Domains Protein: ENSMUSP00000115919
Gene: ENSMUSG00000008682

DomainStartEndE-ValueType
Pfam:Ribosomal_L16 5 167 1.5e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184075
Meta Mutation Damage Score 0.9711 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a deoxyribonuclease protein that shows high sequence similarity to DNase I. The encoded protein is localized to the endoplasmic reticulum and modified by N-linked glycosylation. Alternate transcriptional splice variants encoding the same protein have been observed. [provided by RefSeq, Jan 2015]
PHENOTYPE: Female mice homozygous for an inactivating mutation of this gene exhibit poor motor coordination on the rotarod even on days 4 and 5 of a 5-day test. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T C 4: 88,868,359 I7M unknown Het
4931408C20Rik G A 1: 26,685,425 P225S probably benign Het
A430033K04Rik A G 5: 138,647,776 H641R probably damaging Het
Acyp2 C T 11: 30,506,354 E98K possibly damaging Het
AI464131 T A 4: 41,498,445 N395I probably damaging Het
Asah1 C T 8: 41,354,055 V111M probably damaging Het
Ascc3 T C 10: 50,650,638 L611P probably damaging Het
Atl2 C A 17: 79,865,041 probably null Het
Bhlhe22 A T 3: 18,055,823 S346C probably damaging Het
Bicc1 T C 10: 70,940,483 probably null Het
Bptf G T 11: 107,074,690 A1163D possibly damaging Het
Bub1b T A 2: 118,617,812 C382S probably benign Het
Carmil1 A T 13: 24,013,194 Y158* probably null Het
Ccdc175 A T 12: 72,129,159 I473K probably benign Het
Ccdc18 A G 5: 108,163,759 I444V possibly damaging Het
Cep131 T A 11: 120,065,975 I880F probably damaging Het
Ces2e T A 8: 104,928,796 I117N probably benign Het
Clk2 C T 3: 89,174,224 T289M probably damaging Het
Crocc2 A T 1: 93,194,401 D672V probably benign Het
Cul7 T A 17: 46,651,662 I73N probably damaging Het
Cyp2d12 C A 15: 82,558,965 D358E probably benign Het
Cyp7a1 A G 4: 6,272,788 S142P possibly damaging Het
Daw1 T A 1: 83,205,926 C232* probably null Het
Dhx9 T C 1: 153,478,089 K195R probably damaging Het
Dpp3 A G 19: 4,922,392 V168A probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ercc6l2 T C 13: 63,853,749 V459A probably damaging Het
Erp44 A T 4: 48,243,493 N38K probably damaging Het
Fam135a A G 1: 24,030,740 probably null Het
Fblim1 G A 4: 141,584,722 R231C probably damaging Het
Fdps T C 3: 89,099,433 E117G possibly damaging Het
Gbp4 A C 5: 105,135,164 V80G possibly damaging Het
Glt1d1 A T 5: 127,677,271 D179V probably damaging Het
Gtf2a1l T A 17: 88,694,658 V314E probably null Het
Gzmf G T 14: 56,205,986 Y178* probably null Het
Hira C T 16: 18,932,977 P509S probably benign Het
Ifi44 T C 3: 151,749,186 N134S probably benign Het
Igfbp2 T A 1: 72,824,799 C74S probably damaging Het
Il24 A G 1: 130,885,698 L54P probably damaging Het
Ints10 T C 8: 68,822,252 probably null Het
Ipo9 A G 1: 135,390,573 C700R possibly damaging Het
Kalrn T A 16: 34,212,885 Q469L probably damaging Het
Lrp1b T G 2: 40,860,655 I2966L probably benign Het
Lta C A 17: 35,203,841 V169L possibly damaging Het
Lyst T C 13: 13,759,379 V3554A possibly damaging Het
Mobp A G 9: 120,168,326 probably benign Het
Olfr32 A T 2: 90,138,610 C176* probably null Het
Olfr892-ps1 T C 9: 38,190,003 S93P probably benign Het
Olfr959 C G 9: 39,573,253 R2T probably benign Het
Pacs1 A T 19: 5,152,372 probably null Het
Phf21a G T 2: 92,351,608 probably null Het
Pick1 T A 15: 79,239,696 M89K probably damaging Het
Pik3cb T C 9: 99,064,099 D558G possibly damaging Het
Pnmal1 A G 7: 16,960,736 D172G probably benign Het
Polr2a A C 11: 69,736,977 V1368G probably damaging Het
Pomt2 A G 12: 87,111,335 probably null Het
Pou2f1 T C 1: 165,875,487 probably benign Het
Rnf145 T C 11: 44,555,191 V284A probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Ryr3 C T 2: 112,954,294 probably null Het
Scamp1 A C 13: 94,208,227 L202R possibly damaging Het
Snx25 C T 8: 46,105,203 V110I probably benign Het
Susd6 T A 12: 80,868,614 H124Q possibly damaging Het
Tarm1 T C 7: 3,489,204 T248A probably benign Het
Tc2n A G 12: 101,709,489 M1T probably null Het
Tcerg1 C A 18: 42,511,498 probably null Het
Ticrr C A 7: 79,693,968 P1194T probably damaging Het
Trim31 T G 17: 36,909,599 V469G probably benign Het
Vcp T C 4: 42,980,941 E723G probably benign Het
Vmn1r177 C A 7: 23,865,842 S203I probably damaging Het
Vmn1r177 T A 7: 23,865,843 S203C probably damaging Het
Vmn1r210 A T 13: 22,828,107 L3* probably null Het
Wdr27 T A 17: 14,932,534 R104* probably null Het
Wnk1 A C 6: 119,963,786 probably null Het
Zfp157 A G 5: 138,455,019 E88G possibly damaging Het
Zfp708 A T 13: 67,074,901 L22Q probably damaging Het
Zfp788 T C 7: 41,650,361 F787S probably damaging Het
Other mutations in Dnase1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4691:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4752:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4753:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4814:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4815:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4846:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4861:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4862:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4872:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4873:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4875:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4978:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4979:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4980:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4981:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4982:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R4983:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5039:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5084:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5085:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5086:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5087:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5106:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5107:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5108:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5109:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5137:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5171:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5266:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5296:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5330:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5417:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5418:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5419:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5448:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5466:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R5467:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6126:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6129:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6130:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6232:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6233:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6234:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6242:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6305:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6306:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6329:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6343:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6344:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6396:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6397:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6449:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6450:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6585:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6586:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6646:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6679:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6681:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6845:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
R6847:Dnase1l1 UTSW X 74277038 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTAAAGATTGGTACCAGAGTGGC -3'
(R):5'- TTGGAGGGTTCCTGATGCAC -3'

Sequencing Primer
(F):5'- TACCAGAGTGGCTGCAGAC -3'
(R):5'- GGTTCCTGATGCACACATAGCAATG -3'
Posted On2017-10-10