Incidental Mutation 'R6129:Gm5114'
ID487571
Institutional Source Beutler Lab
Gene Symbol Gm5114
Ensembl Gene ENSMUSG00000053742
Gene Namepredicted gene 5114
Synonyms
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6129 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location39407294-39413160 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 39408600 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 532 (A532T)
Ref Sequence ENSEMBL: ENSMUSP00000103652 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108017]
Predicted Effect possibly damaging
Transcript: ENSMUST00000108017
AA Change: A532T

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000103652
Gene: ENSMUSG00000053742
AA Change: A532T

DomainStartEndE-ValueType
Pfam:DUF4629 435 580 2.5e-65 PFAM
low complexity region 709 726 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Crim1 A G 17: 78,281,309 D271G probably benign Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Gm5114
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01081:Gm5114 APN 7 39410647 splice site probably benign
IGL01295:Gm5114 APN 7 39407817 missense probably damaging 1.00
IGL01349:Gm5114 APN 7 39409107 missense probably benign
IGL01633:Gm5114 APN 7 39408066 missense probably benign
IGL01634:Gm5114 APN 7 39408647 missense probably benign
IGL02072:Gm5114 APN 7 39411402 missense probably benign 0.00
FR4304:Gm5114 UTSW 7 39411105 missense probably benign
FR4304:Gm5114 UTSW 7 39411106 missense probably benign 0.00
R0034:Gm5114 UTSW 7 39408858 missense possibly damaging 0.83
R0127:Gm5114 UTSW 7 39408456 missense probably benign 0.00
R0328:Gm5114 UTSW 7 39408461 missense probably damaging 1.00
R0387:Gm5114 UTSW 7 39408809 missense probably benign 0.15
R0693:Gm5114 UTSW 7 39408764 missense probably benign 0.00
R1006:Gm5114 UTSW 7 39409086 missense probably damaging 1.00
R2039:Gm5114 UTSW 7 39409188 missense probably damaging 1.00
R3433:Gm5114 UTSW 7 39409197 missense probably benign 0.02
R3834:Gm5114 UTSW 7 39408737 missense possibly damaging 0.69
R4320:Gm5114 UTSW 7 39407627 missense probably damaging 1.00
R5214:Gm5114 UTSW 7 39408368 missense probably benign 0.19
R5443:Gm5114 UTSW 7 39408865 missense probably benign 0.00
R5471:Gm5114 UTSW 7 39409110 nonsense probably null
R5707:Gm5114 UTSW 7 39411276 missense probably benign 0.01
R6234:Gm5114 UTSW 7 39409344 missense probably benign 0.19
R6326:Gm5114 UTSW 7 39408155 missense probably benign
R6443:Gm5114 UTSW 7 39407717 missense possibly damaging 0.91
R6530:Gm5114 UTSW 7 39408090 missense probably damaging 1.00
R6743:Gm5114 UTSW 7 39408573 missense probably benign 0.42
R6770:Gm5114 UTSW 7 39408543 missense possibly damaging 0.94
R6885:Gm5114 UTSW 7 39408156 missense probably benign 0.01
R6980:Gm5114 UTSW 7 39409200 missense probably benign 0.01
R7100:Gm5114 UTSW 7 39408284 missense possibly damaging 0.52
R7215:Gm5114 UTSW 7 39411371 missense probably benign 0.02
R7254:Gm5114 UTSW 7 39408966 missense probably benign 0.35
R7343:Gm5114 UTSW 7 39408756 missense probably damaging 1.00
R7366:Gm5114 UTSW 7 39409344 missense possibly damaging 0.69
R7474:Gm5114 UTSW 7 39407980 missense probably benign 0.01
R7499:Gm5114 UTSW 7 39409065 missense possibly damaging 0.55
R8022:Gm5114 UTSW 7 39409376 missense probably benign
R8121:Gm5114 UTSW 7 39408128 missense probably benign 0.15
R8201:Gm5114 UTSW 7 39410949 missense probably damaging 0.98
R8212:Gm5114 UTSW 7 39411252 missense probably benign 0.18
R8321:Gm5114 UTSW 7 39410849 missense possibly damaging 0.85
Z1088:Gm5114 UTSW 7 39408447 missense probably damaging 1.00
Z1177:Gm5114 UTSW 7 39409326 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TGTAGTAACTGAGCTTGGGCC -3'
(R):5'- CAGTGACAGGGCTATTGACAAC -3'

Sequencing Primer
(F):5'- AACTGAGCTTGGGCCTGGATC -3'
(R):5'- CAGGGCTATTGACAACATGGC -3'
Posted On2017-10-10